CWC15      CRISPR in HepG2      Batch: BGHcLV49

Experiment Information (Status: Sequencing)
BGHcLV49-19BGHcLV49-20
idx00
TRCN#_or_BGC#BGC#0000730BGC#0000730
shRNA_or_gRNA_sequenceGCAGGAATCTGGTCTAACCGGCAGGAATCTGGTCTAACCG
PAMTGGTGG
NameCWC15_97CWC15_97
Sample_IDBGHcLV49-19BGHcLV49-20
transduction_Date6/6/256/6/25
daysD6D6
RBP_nameCWC15CWC15
qPCR_result66.770.2
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc47914525
WB_result67.459.8
Ave_WB
WB_DONE_date6/17/25
MW27KD
IPRabbit / I
antibody_Cat#A304-900ALOT #1
Antibody DCC IDENCAB616CRG
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID98999900




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
CWC15Product_ID: A304-900A
Lot_ID: 1
Source: Bethyl Labs
Target Name: CWC15-human
CWC15-hepg2-CRISPR-A304-900A-LICOR.png<br>Caption: Western blot following CRISPR against CWC15 in HepG2 whole cell lysate using CWC15 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against CWC15. CWC15 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
Bethyl_A304-901A_1_CWC15.png<br>Caption: IP-WB analysis of K562 whole cell lysate using the CWC15 specific antibody, A304-900A. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the CWC15-specific antibody, A304-900A. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
cwc15-K562-CRISPR-A304-900A.png<br>Caption: Western blot following CRISPR against CWC15 in K562 whole cell lysate using CWC15 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against CWC15. CWC15 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGHcLV49-19BGHcLV49-20
Sample_IDBGHcLV49-19BGHcLV49-20
Sample Name
Sample NameCWC15-BGHcLV49-19CWC15-BGHcLV49-20
RBPCWC15CWC15
Cell_LineHepG2HepG2
Exp UID
StatusSequencingSequencing
Status_date2025-09-292025-09-29
ProjectENCORE2ENCORE2
Note
ID1433814339




Library-Prep Information
BGHcLV49-19BGHcLV49-20
Sample #3536
Sample NameCWC15-BGHcLV49-19CWC15-BGHcLV49-20
Sample_Name_Alias
Index Well PositionE05F05
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2025-08-202025-08-20
Lib_IDLib-250820Lib-250820
Tecan_Location
Tecan
Tecan_date
Size_bp262252
Peak_Molarity89.4075.40
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2025-09-102025-09-10
Sample_IDBGHcLV49-19BGHcLV49-20
RBPCWC15CWC15
Batch_IDBGHcLV49BGHcLV49
WB_result67.40059.800
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID47804781




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database