COPB1      CRISPR in HepG2      Batch: BGHcLV47

Experiment Information (Status: Sequenced)
BGHcLV47-9BGHcLV47-10
idx00
TRCN#_or_BGC#BGC#0001228BGC#0001228
shRNA_or_gRNA_sequenceATAACCAGAAACCATGACGGATAACCAGAAACCATGACGG
PAMCGGCGG
NameCOPB1_89UCOPB1_89U
Sample_IDBGHcLV47-9BGHcLV47-10
transduction_Date1/28/251/28/25
daysD6D6
RBP_nameCOPB1COPB1
qPCR_result0.00.0
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc18252027
WB_result60.059.2
Ave_WB
WB_DONE_date2/5/25
MW107kd
IPRabbit / I
antibody_Cat#A304-723ALOT #1
Antibody DCC IDENCAB732UJL
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID97969797




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
COPB1Product_ID: A304-723A
Lot_ID: 1
Source: Bethyl Labs
Target Name: COPB1-human
COPB1-HEPG2-CRISPR-A304-723A.png<br>Caption: Western blot following CRISPR against COPB1 in HepG2 whole cell lysate using COPB1 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against COPB1. COPB1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
Bethyl_A304-723A_1_COPB1.png<br>Caption: IP-WB analysis of K562 whole cell lysate using the COPB1 specific antibody, A304-723A. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the COPB1-specific antibody, A304-723A. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
COPB1-K562-CRISPR-A304-723A.png<br>Caption: Western blot following CRISPR against COPB1 in K562 whole cell lysate using COPB1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against COPB1. COPB1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGHcLV47-9BGHcLV47-10
Sample_IDBGHcLV47-9BGHcLV47-10
Sample Name
Sample NameCOPB1-BGHcLV47-9COPB1-BGHcLV47-10
RBPCOPB1COPB1
Cell_LineHepG2HepG2
Exp UID
StatusSequencedSequenced
Status_date2025-05-142025-05-14
ProjectENCORE2ENCORE2
Note
ID1415414155




Library-Prep Information
BGHcLV47-9BGHcLV47-10
Sample #78
Sample NameCOPB1-BGHcLV47-9COPB1-BGHcLV47-10
Sample_Name_Alias
Index Well PositionG08H08
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2025-04-232025-04-23
Lib_IDLib-250423Lib-250423
Tecan_Location
Tecan
Tecan_date
Size_bp256268
Peak_Molarity33.4045.90
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2025-04-222025-04-22
Sample_IDBGHcLV47-9BGHcLV47-10
RBPCOPB1COPB1
Batch_IDBGHcLV47BGHcLV47
WB_result60.00059.200
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID47184719




Sequencing Information
BGHcLV47-9BGHcLV47-10
Sample_IDBGHcLV47-9BGHcLV47-10
Sample NameCOPB1-BGHcLV47-9COPB1-BGHcLV47-10
Pool IDPool-250422Pool-250422
LocalServer_folder
total_reads00
total_aligned_reads00
unique_aligned_reads00
percent_uniqueAligned
correlation_replicates
spikein_reads00
percent_spikeins
original_ReadLength
QC_StatusReadyToQCReadyToQC
ID34213422




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database