Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RPS12
CRISPR
in HepG2
Batch: BGHcLV47
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequenced
)
BGHcLV47-57
BGHcLV47-58
idx
0
0
TRCN#_or_BGC#
BGC#0001262
BGC#0001262
shRNA_or_gRNA_sequence
TCACCCTTCCTCGGCCATGG
TCACCCTTCCTCGGCCATGG
PAM
CGG
CGG
Name
RPS12_78U
RPS12_78U
Sample_ID
BGHcLV47-57
BGHcLV47-58
transduction_Date
1/28/25
1/28/25
days
D6
D6
RBP_name
RPS12
RPS12
qPCR_result
51.7
42.6
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
3035
4260
WB_result
89.4
93.8
Ave_WB
WB_DONE_date
2/5/25
MW
15KD
IP
antibody_Cat#
A305-037A
LOT #1
Antibody DCC ID
ENCAB450FMJ
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
9844
9845
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
RPS12
Product_ID:
A305-037A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RPS12-human
Experiment Status
BGHcLV47-57
BGHcLV47-58
Sample_ID
BGHcLV47-57
BGHcLV47-58
Sample Name
Sample Name
RPS12-BGHcLV47-57
RPS12-BGHcLV47-58
RBP
RPS12
RPS12
Cell_Line
HepG2
HepG2
Exp UID
Status
Sequenced
Sequenced
Status_date
2025-05-14
2025-05-14
Project
ENCORE2
ENCORE2
Note
ID
14172
14173
Library-Prep
Sequencing
Library-Prep Information
BGHcLV47-57
BGHcLV47-58
Sample #
25
26
Sample Name
RPS12-BGHcLV47-57
RPS12-BGHcLV47-58
Sample_Name_Alias
Index Well Position
A11
B11
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-04-23
2025-04-23
Lib_ID
Lib-250423
Lib-250423
Tecan_Location
Tecan
Tecan_date
Size_bp
262
257
Peak_Molarity
66.20
21.50
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-04-22
2025-04-22
Sample_ID
BGHcLV47-57
BGHcLV47-58
RBP
RPS12
RPS12
Batch_ID
BGHcLV47
BGHcLV47
WB_result
89.400
93.800
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4736
4737
Sequencing Information
BGHcLV47-57
BGHcLV47-58
Sample_ID
BGHcLV47-57
BGHcLV47-58
Sample Name
RPS12-BGHcLV47-57
RPS12-BGHcLV47-58
Pool ID
Pool-250422
Pool-250422
LocalServer_folder
total_reads
0
0
total_aligned_reads
0
0
unique_aligned_reads
0
0
percent_uniqueAligned
correlation_replicates
spikein_reads
0
0
percent_spikeins
original_ReadLength
QC_Status
ReadyToQC
ReadyToQC
ID
3439
3440
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back