Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
HNRNPD
CRISPR
in HepG2
Batch: BGHcLV47
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Sequenced
)
BGHcLV47-39
BGHcLV47-40
idx
0
0
TRCN#_or_BGC#
BGC#0000192
BGC#0000192
shRNA_or_gRNA_sequence
GTCGGAGGAGCAGTTCGGCG
GTCGGAGGAGCAGTTCGGCG
PAM
GGG
GGG
Name
HNRNPD-93F
HNRNPD-93F
Sample_ID
BGHcLV47-39
BGHcLV47-40
transduction_Date
1/28/25
1/28/25
days
D6
D6
RBP_name
HNRNPD
HNRNPD
qPCR_result
68.1
57.1
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
4471
3965
WB_result
93.7
96.9
Ave_WB
WB_DONE_date
3/11/25
MW
38kd
TUBULIN
IP
fu's #18
antibody_Cat#
#12382
lot # 1
Antibody DCC ID
ENCAB870XOX
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Ready
Ready
Library_start_date
repeat_library
Note
ID
9826
9827
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
HNRNPD
Product_ID:
12382
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: HNRNPD-human
Experiment Status
BGHcLV47-39
BGHcLV47-40
Sample_ID
BGHcLV47-39
BGHcLV47-40
Sample Name
Sample Name
HNRNPD-BGHcLV47-39
HNRNPD-BGHcLV47-40
RBP
HNRNPD
HNRNPD
Cell_Line
HepG2
HepG2
Exp UID
Status
Sequenced
Sequenced
Status_date
2025-05-14
2025-05-14
Project
ENCORE2
ENCORE2
Note
ID
14160
14161
Library-Prep
Sequencing
Library-Prep Information
BGHcLV47-39
BGHcLV47-40
Sample #
13
14
Sample Name
HNRNPD-BGHcLV47-39
HNRNPD-BGHcLV47-40
Sample_Name_Alias
Index Well Position
E09
F09
Index_table
IDT_UniqueDualIndex_96_V2
IDT_UniqueDualIndex_96_V2
LibPrep_date
2025-04-23
2025-04-23
Lib_ID
Lib-250423
Lib-250423
Tecan_Location
Tecan
Tecan_date
Size_bp
260
267
Peak_Molarity
55.90
36.00
libSampleQC_DNA_Well
RIN
libSample_RNA_Well
SampleQC_method
TapeStation_2022
TapeStation_2022
SampleQC_date
2025-04-22
2025-04-22
Sample_ID
BGHcLV47-39
BGHcLV47-40
RBP
HNRNPD
HNRNPD
Batch_ID
BGHcLV47
BGHcLV47
WB_result
93.700
96.900
Library Description
TruSeq mRNA
TruSeq mRNA
Repeat_Library_Suffix
Lib_Status
SendToSequence
SendToSequence
Project
ENCORE2
ENCORE2
ID
4724
4725
Sequencing Information
BGHcLV47-39
BGHcLV47-40
Sample_ID
BGHcLV47-39
BGHcLV47-40
Sample Name
HNRNPD-BGHcLV47-39
HNRNPD-BGHcLV47-40
Pool ID
Pool-250422
Pool-250422
LocalServer_folder
total_reads
0
0
total_aligned_reads
0
0
unique_aligned_reads
0
0
percent_uniqueAligned
correlation_replicates
spikein_reads
0
0
percent_spikeins
original_ReadLength
QC_Status
ReadyToQC
ReadyToQC
ID
3427
3428
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back