Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
non-target
CRISPR
in HepG2
Batch: BGHcLV03
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
List KD experiments controlled by BGHcLV03-2-D40 and BGHcLV03-2-D40
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHcLV03-2-D40
BGHcLV03-2-D40
idx
33
33
TRCN#_or_BGC#
BGC#0000000
BGC#0000000
shRNA_or_gRNA_sequence
CAGTCGGGCGTCATCATGAT
CAGTCGGGCGTCATCATGAT
PAM
Name
non -target
non -target
Sample_ID
BGHcLV03-2-D40
BGHcLV03-2-D40
transduction_Date
12/16/2015
12/16/2015
days
D40
D40
RBP_name
non-target
non-target
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
0
0
WB_result
Ave_WB
WB_DONE_date
MW
IP
antibody_Cat#
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
8222
8222
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHcLV03-2-D40
BGHcLV03-2-D40
Sample_ID
BGHcLV03-2-D40
BGHcLV03-2-D40
Sample Name
DGCR8-D40_BGHcLV03-16
DGCR8-D40_BGHcLV03-16
Sample Name
RBP
DGCR8
DGCR8
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2016-03-09
2016-03-09
Project
ENCODE3
ENCODE3
Note
ID
51
51
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back