non-target      CRISPR in HepG2      Batch: BGHcLV03

General Information

List KD experiments controlled by BGHcLV03-1-D29 and BGHcLV03-1-D29





Experiment Information (Status: NotSatisfied)
BGHcLV03-1-D29BGHcLV03-1-D29
idx2828
TRCN#_or_BGC#BGC#0000000BGC#0000000
shRNA_or_gRNA_sequenceCAGTCGGGCGTCATCATGATCAGTCGGGCGTCATCATGAT
PAM
Namenon -targetnon -target
Sample_IDBGHcLV03-1-D29BGHcLV03-1-D29
transduction_Date12/16/201512/16/2015
daysD29D29
RBP_namenon-targetnon-target
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc00
WB_result
Ave_WB
WB_DONE_date
MW
IP
antibody_Cat#
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID82178217




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHcLV03-1-D29BGHcLV03-1-D29
Sample_IDBGHcLV03-1-D29BGHcLV03-1-D29
Sample NameDGCR8-D29_BGHcLV03-15DGCR8-D29_BGHcLV03-15
Sample Name
RBPDGCR8DGCR8
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2016-03-092016-03-09
ProjectENCODE3ENCODE3
Note
ID4848




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database