Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
POLK
shRNA
in HepG2
Batch: BGHLV37
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV37-37
BGHLV37-38
idx
949
950
TRCN#_or_BGC#
TRCN0000115997
TRCN0000115997
shRNA_or_gRNA_sequence
GCATTGATCCTAGTGTCTTTA
GCATTGATCCTAGTGTCTTTA
PAM
Name
POLK
POLK
Sample_ID
BGHLV37-37
BGHLV37-38
transduction_Date
9/1/16
9/1/16
days
RBP_name
POLK
POLK
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2509
2837
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
9/14/16
wes
MW
99kDa
IP
1
1
antibody_Cat#
A301-977A
A301-977A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
3046
3047
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV37-37
BGHLV37-38
Sample_ID
BGHLV37-37
BGHLV37-38
Sample Name
Sample Name
RBP
POLK
POLK
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2271
2272
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back