Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
SF3B1
shRNA
in HepG2
Control:
NT_BGHLV35
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
SF3B1
Cell_Line
HepG2
Method
shRNA
Exp_Name
SF3B1-BGHLV35-HepG2
ENCODE_series_ID
ENCSR144FRZ
Batch_ID
BGHLV35
Pool ID
Pool-160912
Local_Set_Name
set35
ENCODE_KD_Exp_ID
ENCSR896CFV
ENCODE_CN_Exp_ID
ENCSR264TUE
Rep1
SF3B1_BGHLV35-41
Rep2
SF3B1_BGHLV35-42
CN1
NT_BGHLV35-1
CN2
NT_BGHLV35-2
Rep1_qPCR
67.5
Rep2_qPCR
54.2
Rep1_WB
63.6
Rep2_WB
75.0
Antibody Cat#
ab66774
Antibody Lot#
ab66774
Antibody DCC ID
ENCAB022ALQ
Status
Released
Project
ENCODE3
ID
738
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV35-39
BGHLV35-40
idx
895
896
TRCN#_or_BGC#
TRCN0000000074
TRCN0000000074
shRNA_or_gRNA_sequence
PAM
Name
SF3B1
SF3B1
Sample_ID
BGHLV35-39
BGHLV35-40
transduction_Date
4/29/16
4/29/16
days
RBP_name
SF3B1
SF3B1
qPCR_result
51.7
48.4
Ave_qPCR
50.0
RT-qPCR_primer-F
ATCAAGTTGGGATCAGGCAG
RT-qPCR_primer-R
CAGGAGTCTCGCTTCCCTTT
protein_conc
3572
3728
WB_result
Ave_WB
WB_DONE_date
MW
146kDa
IP
antibody_Cat#
ab66774
ab66774
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
2988
2989
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV35-39
BGHLV35-40
Sample_ID
BGHLV35-39
BGHLV35-40
Sample Name
Sample Name
RBP
SF3B1
SF3B1
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2237
2238
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back