Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
PRPF4
shRNA
in HepG2
Batch: BGHLV35
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV35-31
BGHLV35-32
idx
887
888
TRCN#_or_BGC#
TRCN0000074769
TRCN0000074769
shRNA_or_gRNA_sequence
CGTTGTATCATGTTCTTAGAA
CGTTGTATCATGTTCTTAGAA
PAM
Name
PRPF4
PRPF4
Sample_ID
BGHLV35-31
BGHLV35-32
transduction_Date
4/29/16
4/29/16
days
RBP_name
PRPF4
PRPF4
qPCR_result
67.0
80.2
Ave_qPCR
73.6
RT-qPCR_primer-F
ctgcatcaggaaggccatag
RT-qPCR_primer-R
aaactcgaccaaatgcatcc
protein_conc
3656
3047
WB_result
10.9
11.3
Ave_WB
11.1
WB_DONE_date
5/10/2016
WES
MW
60kDa
IP
1
1
antibody_Cat#
RN093PW
RN093PW
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
2980
2981
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV35-31
BGHLV35-32
Sample_ID
BGHLV35-31
BGHLV35-32
Sample Name
Sample Name
RBP
PRPF4
PRPF4
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2229
2230
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back