Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
AUH
shRNA
in HepG2
Batch: BGHLV35
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV35-3
BGHLV35-4
idx
859
860
TRCN#_or_BGC#
TRCN0000052451
TRCN0000052451
shRNA_or_gRNA_sequence
PAM
Name
AUH
AUH
Sample_ID
BGHLV35-3
BGHLV35-4
transduction_Date
4/29/16
4/29/16
days
RBP_name
AUH
AUH
qPCR_result
0.0
0.0
Ave_qPCR
0.0
RT-qPCR_primer-F
aaaaggggctacagctctga
RT-qPCR_primer-R
attccaagcaccacaattcc
protein_conc
3444
3307
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
7/11/16
WES
MW
36kDa
IP
1IP
1IP
antibody_Cat#
RN037P
RN037P
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
2952
2953
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV35-3
BGHLV35-4
Sample_ID
BGHLV35-3
BGHLV35-4
Sample Name
Sample Name
RBP
AUH
AUH
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2217
2218
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back