Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
ZFC3H1
shRNA
in HepG2
Batch: BGHLV33
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV33-45
BGHLV33-46
idx
853
854
TRCN#_or_BGC#
TRCN0000130498
TRCN0000130498
shRNA_or_gRNA_sequence
PAM
Name
ZFC3H1
ZFC3H1
Sample_ID
BGHLV33-45
BGHLV33-46
transduction_Date
11/17/2015
11/17/2015
days
RBP_name
ZFC3H1
ZFC3H1
qPCR_result
0.0
0.0
Ave_qPCR
0.0
RT-qPCR_primer-F
ggaagaaatgctgcttcgag
RT-qPCR_primer-R
ggaggtgaaggtgggtcact
protein_conc
3611
3167
WB_result
Ave_WB
WB_DONE_date
MW
226kDa
IP
1
1
antibody_Cat#
A301-455A
A301-455A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
7.2
0
Rep2_TPM
7.6
0
Action
Library_start_date
repeat_library
Note
ID
2946
2947
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV33-45
BGHLV33-46
Sample_ID
BGHLV33-45
BGHLV33-46
Sample Name
Sample Name
RBP
ZFC3H1
ZFC3H1
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2215
2216
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back