MARK2      shRNA in HepG2      Batch: BGHLV33

Experiment Information (Status: NotSatisfied)
BGHLV33-17BGHLV33-18
idx825826
TRCN#_or_BGC#TRCN0000001585TRCN0000001585
shRNA_or_gRNA_sequence
PAM
NameMARK2MARK2
Sample_IDBGHLV33-17BGHLV33-18
transduction_Date11/17/201511/17/2015
days
RBP_nameMARK2MARK2
qPCR_result28.228.8
Ave_qPCR28.5
RT-qPCR_primer-Fccccatcccacaaggtacag
RT-qPCR_primer-Rtagaggtgggaatggcagga
protein_conc57474843
WB_result
Ave_WB
WB_DONE_date
MW88kDa
IP11
antibody_Cat#A303-135AA303-135A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM4.20
Rep2_TPM5.10
Action
Library_start_date
repeat_library
Note
ID29182919




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV33-17BGHLV33-18
Sample_IDBGHLV33-17BGHLV33-18
Sample Name
Sample Name
RBPMARK2MARK2
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID21952196




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database