ZNF106      shRNA in HepG2      Batch: BGHLV31

Experiment Information (Status: NotSatisfied)
BGHLV31-59BGHLV31-60
idx807808
TRCN#_or_BGC#TRCN0000107379TRCN0000107379
shRNA_or_gRNA_sequenceGCAGGACATATTGAACGACATGCAGGACATATTGAACGACAT
PAM
NameZFP106ZFP106
Sample_IDBGHLV31-59BGHLV31-60
transduction_Date9/24/20159/24/2015
days
RBP_nameZNF106ZNF106
qPCR_result68.272.4
Ave_qPCR70.3
RT-qPCR_primer-Fctcagactgtgatctcctcca
RT-qPCR_primer-Ragcttccttctgtgggttca
protein_conc20564455
WB_result
Ave_WBNO Band on the positionneed diffident method
WB_DONE_date11/9/2015
MW269kDa
IP1IP1IP
antibody_Cat#A301-527AA301-527A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM9.80
Rep2_TPM10.20
Action
Library_start_date
repeat_library
Note
ID29002901




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV31-59BGHLV31-60
Sample_IDBGHLV31-59BGHLV31-60
Sample Name
Sample Name
RBPZNF106ZNF106
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID21792180




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database