Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
GOLGB1
shRNA
in HepG2
Batch: BGHLV31
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV31-37
BGHLV31-38
idx
785
786
TRCN#_or_BGC#
TRCN0000147752
TRCN0000147752
shRNA_or_gRNA_sequence
GCAGACAATCTCAAGTTGAAA
GCAGACAATCTCAAGTTGAAA
PAM
Name
GOLGB1
GOLGB1
Sample_ID
BGHLV31-37
BGHLV31-38
transduction_Date
9/24/2015
9/24/2015
days
RBP_name
GOLGB1
GOLGB1
qPCR_result
70.4
68.2
Ave_qPCR
69.3
RT-qPCR_primer-F
gctgctggaagaagaacgag
RT-qPCR_primer-R
gggaagagtcccattcactg
protein_conc
4710
4970
WB_result
Ave_WB
WB_DONE_date
12/2/2015
MW
376kDa
IP
1MW
1MW
antibody_Cat#
A304-033A
A304-033A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
41.6
0
Rep2_TPM
33.7
0
Action
Library_start_date
repeat_library
Note
ID
2878
2879
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV31-37
BGHLV31-38
Sample_ID
BGHLV31-37
BGHLV31-38
Sample Name
Sample Name
RBP
GOLGB1
GOLGB1
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2167
2168
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back