Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
DGCR8
shRNA
in HepG2
Batch: BGHLV31
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV31-31
BGHLV31-32
idx
779
780
TRCN#_or_BGC#
TRCN0000159648
TRCN0000159648
shRNA_or_gRNA_sequence
GACAATTTGGAGCTAGATGAA
GACAATTTGGAGCTAGATGAA
PAM
Name
DGCR8
DGCR8
Sample_ID
BGHLV31-31
BGHLV31-32
transduction_Date
9/24/2015
9/24/2015
days
RBP_name
DGCR8
DGCR8
qPCR_result
12.9
1.9
Ave_qPCR
7.4
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
5279
5243
WB_result
Ave_WB
WB_DONE_date
MW
86kDa
IP
1
1
antibody_Cat#
A302-468A
A302-468A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
5.5
0
Rep2_TPM
6.3
0
Action
Library_start_date
repeat_library
Note
ID
2872
2873
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV31-31
BGHLV31-32
Sample_ID
BGHLV31-31
BGHLV31-32
Sample Name
Sample Name
RBP
DGCR8
DGCR8
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2165
2166
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back