Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
AQR
shRNA
in HepG2
Batch: BGHLV31
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV31-11
BGHLV31-12
idx
759
760
TRCN#_or_BGC#
TRCN0000074868
TRCN0000074868
shRNA_or_gRNA_sequence
GCAAATAACCATTCCTTTCAT
GCAAATAACCATTCCTTTCAT
PAM
Name
AQR
AQR
Sample_ID
BGHLV31-11
BGHLV31-12
transduction_Date
9/24/2015
9/24/2015
days
RBP_name
AQR
AQR
qPCR_result
65.7
66.7
Ave_qPCR
66.2
RT-qPCR_primer-F
ccaacagaacctttcccaac
RT-qPCR_primer-R
gccatctggggcatattttt
protein_conc
5667
4911
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
12/2/2015
MW
171kDa
IP
1
1
antibody_Cat#
A302-547A
A302-547A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
7.6
0
Rep2_TPM
5.8
0
Action
Library_start_date
repeat_library
Note
ID
2852
2853
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV31-11
BGHLV31-12
Sample_ID
BGHLV31-11
BGHLV31-12
Sample Name
Sample Name
RBP
AQR
AQR
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2149
2150
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back