SSB      shRNA in HepG2      Batch: BGHLV30

Experiment Information (Status: NotSatisfied)
BGHLV30-49BGHLV30-50
idx737738
TRCN#_or_BGC#TRCN0000062193TRCN0000062193
shRNA_or_gRNA_sequenceGCCACGGGACAAGTTTCTAAAGCCACGGGACAAGTTTCTAAA
PAM
NameSSB-93SSB-93
Sample_IDBGHLV30-49BGHLV30-50
transduction_Date8/25/20158/25/2015
days
RBP_nameSSBSSB
qPCR_result20.45.4
Ave_qPCR12.9
RT-qPCR_primer-FTTCTCAAATCATGGTGAAATAAA
RT-qPCR_primer-RCCAATGCTTCCTTGGCTTT
protein_conc41974632
WB_result
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#RN074PWRN074PW
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM174.50
Rep2_TPM147.10
Action
Library_start_date
repeat_library
Note
ID28282829




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV30-49BGHLV30-50
Sample_IDBGHLV30-49BGHLV30-50
Sample Name
Sample Name
RBPSSBSSB
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID21392140




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database