FIP1L1      shRNA in HepG2      Control: NT_BGHLV30

General Information
RBPFIP1L1
Cell_LineHepG2
MethodshRNA
Exp_NameFIP1L1-BGHLV30-HepG2
ENCODE_series_IDENCSR563NSV
Batch_IDBGHLV30
Pool IDPool-151215A
Local_Set_Nameset30
ENCODE_KD_Exp_IDENCSR116QBU
ENCODE_CN_Exp_IDENCSR067GHD
Rep1FIP1L1_BGHLV30-39
Rep2FIP1L1_BGHLV30-40
CN1NT_BGHLV30-1
CN2NT_BGHLV30-2
Rep1_qPCR57.5
Rep2_qPCR66.0
Rep1_WB50.9
Rep2_WB49.2
Antibody Cat#A301-461A
Antibody Lot#A301-461A
Antibody DCC IDENCAB786ENG
StatusReleased
ProjectENCODE3
ID679




Experiment Information (Status: Released)
BGHLV30-39BGHLV30-39BGHLV30-40BGHLV30-40
idx725727726728
TRCN#_or_BGC#TRCN0000074418TRCN0000074418TRCN0000074418TRCN0000074418
shRNA_or_gRNA_sequenceGTACCAGAAGTAGATACTATAGTACCAGAAGTAGATACTATAGTACCAGAAGTAGATACTATAGTACCAGAAGTAGATACTATA
PAM
NameFIP1L1FIP1L1FIP1L1FIP1L1
Sample_IDBGHLV30-39BGHLV30-39BGHLV30-40BGHLV30-40
transduction_Date8/25/20158/25/20158/25/20158/25/2015
days
RBP_nameFIP1L1FIP1L1FIP1L1FIP1L1
qPCR_result57.557.566.066.0
Ave_qPCR61.861.8
RT-qPCR_primer-Fcgggacagagaaagagaacgcgggacagagaaagagaacg
RT-qPCR_primer-Rtcgctgttgaaaacacttggtcgctgttgaaaacacttgg
protein_conc4061406140934093
WB_result50.982.049.280.8
Ave_WB50.181.4
WB_DONE_date9/16/201512/3/2015
MW67kDa67kDa
IP1Fu's1
antibody_Cat#A301-461A#A5016A301-461A#A5016
Antibody DCC IDENCAB786ENG ENCAB511DBP ENCAB786ENG ENCAB511DBP
submitted_to_DCC_date12/7/201512/7/2015
Rep1_TPM9.89.800
Rep2_TPM8.18.100
Action
Library_start_date11/5/201511/5/2015
repeat_library
Notex x
ID2816281828172819




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
FIP1L1Product_ID: A5016
Lot_ID: unknown
Source: ABclonal
Target Name: FIP1L1-human
FIP1L1_HepG2.png<br>Caption: IP-Western Blot analysis of HepG2 whole cell lysate using FIP1L1 specific antibody. Lane 1 is 0.5% of ten million whole cell lysate input (lane under '10% input') , lane 2 is 5% of IP enrichment using rabbit normal IgG (lane under 'IgG') and lane 3 is 5% IP enrichment using rabbit polyclonal anti-FIP1L1 antibody (lanes under 'anti-FIP1L1'). Asterisk indicates heavy chain of antibody.
FIP1L1-FU%27S_Secondary_Western.png<br>Caption: Western blot following shRNA against FIP1L1 in K562 and HepG2 whole cell lysate using FIP1L1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different shRNAs against FIP1L1. Lanes 5-8 follow the same pattern, but in HepG2. FIP1L1 protein appears as the green band, Tubulin serves as a control and appears in red.
FIP1L1_K562.png<br>Caption: IP-Western Blot analysis of K562 whole cell lysate using FIP1L1 specific antibody. Lane 1 is 0.5% of ten million whole cell lysate input (lane under '10% input') , lane 2 is 5% of IP enrichment using rabbit normal IgG (lane under 'IgG') and lane 3 is 5% IP enrichment using rabbit polyclonal anti-FIP1L1 antibody (lanes under 'anti-FIP1L1'). Asterisk indicates heavy chain of antibody.
FIP1L1-FU%27S_Secondary_Western.png<br>Caption: Western blot following shRNA against FIP1L1 in K562 and HepG2 whole cell lysate using FIP1L1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different shRNAs against FIP1L1. Lanes 5-8 follow the same pattern, but in HepG2. FIP1L1 protein appears as the green band, Tubulin serves as a control and appears in red.
FIP1L1Product_ID: A301-461A
Lot_ID: 1
Source: Bethyl Labs
Target Name: FIP1L1-human
HepG2_Bethyl_A301-461A_1_FIP1L1.png<br>Caption: IP-Western Blot analysis of HepG2 whole cell lysate using FIP1L1 specific antibody. Lane 1 is 1% of twenty million whole cell lysate input and lane 2 is 25% of IP enrichment using rabbit normal IgG (lanes under 'IgG'). Lane 3 is 1% of twenty million whole cell lysate input and lane 4 is 10% IP enrichment using rabbit polyclonal anti-FIP1L1 antibody (lanes under 'FIP1L1').
FIP1L1_Secondary_Western.png<br>Caption: Western blot following shRNA against FIP1L1 in K562 and HepG2 whole cell lysate using FIP1L1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different shRNAs against FIP1L1. Lanes 5-8 follow the same pattern, but in HepG2. FIP1L1 protein appears as the green band, Tubulin serves as a control and appears in red.
FIP1L1_Secondary_Western.png<br>Caption: Western blot following shRNA against FIP1L1 in K562 and HepG2 whole cell lysate using FIP1L1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different shRNAs against FIP1L1. Lanes 5-8 follow the same pattern, but in HepG2. FIP1L1 protein appears as the green band, Tubulin serves as a control and appears in red.




Experiment Status
BGHLV30-39BGHLV30-40
Sample_IDBGHLV30-39BGHLV30-40
Sample NameFIP1L1_BGHLV30-39FIP1L1_BGHLV30-40
Sample NameFIP1L1_BGHLV30-39FIP1L1_BGHLV30-40
RBPFIP1L1FIP1L1
Cell_LineHepG2HepG2
Exp UID
StatusReleasedReleased
Status_date2016-03-042016-03-04
ProjectENCODE3ENCODE3
Note
ID10561057




Library-Prep Information
BGHLV30-39BGHLV30-40
Sample #
Sample NameFIP1L1-BGHLV30-39FIP1L1-BGHLV30-40
Sample_Name_AliasFIP1L1_BGHLV30-39FIP1L1_BGHLV30-40
Index Well PositionS09S10
Index_tableIDT_TruSeqSingleIndex_24IDT_TruSeqSingleIndex_24
LibPrep_date2015-11-052015-11-05
Lib_IDLib-151105Lib-151105
Tecan_Location
Tecan
Tecan_date
Size_bp
Peak_Molarity
libSampleQC_DNA_WellDNA_Library_LV28-29-30/set1/A11.pngDNA_Library_LV28-29-30/set1/B11.png
RIN10.010.0
libSample_RNA_WellRNA_Library_LV29-30-31-32/set1/C6.pngRNA_Library_LV29-30-31-32/set1/D6.png
SampleQC_method
SampleQC_date
Sample_IDBGHLV30-39BGHLV30-40
RBPFIP1L1FIP1L1
Batch_IDBGHLV30BGHLV30
WB_result50.90049.200
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCODE3ENCODE3
ID27482749




Sequencing Information
BGHLV30-39BGHLV30-40
Sample_IDBGHLV30-39BGHLV30-40
Sample NameFIP1L1_BGHLV30-39FIP1L1_BGHLV30-40
Pool IDPool-151215APool-151215A
LocalServer_folderset30set30
total_reads84,531,962193,927,736
total_aligned_reads67,433,930154,449,114
unique_aligned_reads63,010,044144,045,872
percent_uniqueAligned0.745400.74278
correlation_replicates0.9965260.996526
spikein_reads210,388436,552
percent_spikeins0.002490.00225
original_ReadLength100100
QC_StatusSubmittedSubmitted
ID13681369




Data Submission Information
BGHLV30-39BGHLV30-39
ENCODE_aliasbrenton-graveley:FIP1L1_BGHLV30brenton-graveley:FIP1L1-BGHLV30-HepG2
ENCODE_accessionENCSR116QBUENCSR563NSV
object_typeexperimentgene_silencing_series
assay_typeknockdown followed by RNA-seqknockdown followed by RNA-seq
Sample_IDBGHLV30-39BGHLV30-39
Sample NameFIP1L1_BGHLV30-39FIP1L1_BGHLV30-39
SelectedYesYes
StatusReleasedReleased
Status_Date2016-03-032022-03-01
ProjectENCODE3ENCODE3
protocol_URL
ID30776711




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
FIP1L1_BGHLV30-39_GATCAG_L002_001.R1.fastq.gzENCODE_DATA/set30/fastqfastqreadsknockdown followed by RNA-seqGraveley Lab1368HiSeq2500100paired-ended1NT_BGHLV30-1_GTCCGC_L008_001.R1.fastq.gz,NT_BGHLV30-2_GTGAAA_L008_001.R1.fastq.gzENCODE320714
FIP1L1_BGHLV30-39_GATCAG_L002_001.R2.fastq.gzENCODE_DATA/set30/fastqfastqreadsknockdown followed by RNA-seqGraveley Lab1368HiSeq2500100paired-ended2NT_BGHLV30-1_GTCCGC_L008_001.R2.fastq.gz,NT_BGHLV30-2_GTGAAA_L008_001.R2.fastq.gzENCODE320748
FIP1L1_BGHLV30-39_Aligned.sortedByCoord.out.bamENCODE_DATA/set30/STAR_ENCORE2_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab1368GRCh38V40FIP1L1_BGHLV30-39_GATCAG_L002_001.R1.fastq.gz,FIP1L1_BGHLV30-39_GATCAG_L002_001.R2.fastq.gzENCORE220782
FIP1L1_BGHLV30-39_Signal.Unique.strand+.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1368GRCh38V40FIP1L1_BGHLV30-39/Aligned.sortedByCoord.out.bamENCORE220816
FIP1L1_BGHLV30-39_Signal.Unique.strand-.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1368GRCh38V40FIP1L1_BGHLV30-39/Aligned.sortedByCoord.out.bamENCORE220850
FIP1L1_BGHLV30-39_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1368GRCh38V40FIP1L1_BGHLV30-39/Aligned.sortedByCoord.out.bamENCORE220884
FIP1L1_BGHLV30-39_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1368GRCh38V40FIP1L1_BGHLV30-39/Aligned.sortedByCoord.out.bamENCORE220918
FIP1L1_BGHLV30-39_quant.sfENCODE_DATA/set30/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab1368GRCh38V40FIP1L1_BGHLV30-39_GATCAG_L002_001.R1.fastq.gz,FIP1L1_BGHLV30-39_GATCAG_L002_001.R2.fastq.gzENCORE220952
FIP1L1_BGHLV30-40_TAGCTT_L002_001.R1.fastq.gzENCODE_DATA/set30/fastqfastqreadsknockdown followed by RNA-seqGraveley Lab1369HiSeq2500100paired-ended1NT_BGHLV30-1_GTCCGC_L008_001.R1.fastq.gz,NT_BGHLV30-2_GTGAAA_L008_001.R1.fastq.gzENCODE320715
FIP1L1_BGHLV30-40_TAGCTT_L002_001.R2.fastq.gzENCODE_DATA/set30/fastqfastqreadsknockdown followed by RNA-seqGraveley Lab1369HiSeq2500100paired-ended2NT_BGHLV30-1_GTCCGC_L008_001.R2.fastq.gz,NT_BGHLV30-2_GTGAAA_L008_001.R2.fastq.gzENCODE320749
FIP1L1_BGHLV30-40_Aligned.sortedByCoord.out.bamENCODE_DATA/set30/STAR_ENCORE2_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab1369GRCh38V40FIP1L1_BGHLV30-40_TAGCTT_L002_001.R1.fastq.gz,FIP1L1_BGHLV30-40_TAGCTT_L002_001.R2.fastq.gzENCORE220783
FIP1L1_BGHLV30-40_Signal.Unique.strand+.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1369GRCh38V40FIP1L1_BGHLV30-40/Aligned.sortedByCoord.out.bamENCORE220817
FIP1L1_BGHLV30-40_Signal.Unique.strand-.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1369GRCh38V40FIP1L1_BGHLV30-40/Aligned.sortedByCoord.out.bamENCORE220851
FIP1L1_BGHLV30-40_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1369GRCh38V40FIP1L1_BGHLV30-40/Aligned.sortedByCoord.out.bamENCORE220885
FIP1L1_BGHLV30-40_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set30/STAR_ENCORE2_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1369GRCh38V40FIP1L1_BGHLV30-40/Aligned.sortedByCoord.out.bamENCORE220919
FIP1L1_BGHLV30-40_quant.sfENCODE_DATA/set30/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab1369GRCh38V40FIP1L1_BGHLV30-40_TAGCTT_L002_001.R1.fastq.gz,FIP1L1_BGHLV30-40_TAGCTT_L002_001.R2.fastq.gzENCORE220953