PRRC2C      shRNA in HepG2      Batch: BGHLV27

Experiment Information (Status: NotSatisfied)
BGHLV27-9BGHLV27-10
idx629630
TRCN#_or_BGC#TRCN0000141560TRCN0000141560
shRNA_or_gRNA_sequenceCCTGGATGAATGAGCAGATAACCTGGATGAATGAGCAGATAA
PAM
NameBAT2L2/PRRC2CBAT2L2/PRRC2C
Sample_IDBGHLV27-9BGHLV27-10
transduction_Date6/9/20156/9/2015
days
RBP_namePRRC2CPRRC2C
qPCR_result57.548.9
Ave_qPCR53.2
RT-qPCR_primer-Ftgattgcaaccacaggaaaa
RT-qPCR_primer-Rctaccagcgattggaggtgt
protein_conc44644795
WB_result0.00.0
Ave_WB0.0
WB_DONE_date9/2/2015
MW317kDa
IP1IP1IP
antibody_Cat#A303-315AA303-315A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM400
Rep2_TPM36.90
Action
Library_start_date
repeat_library
Note
ID27202721




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV27-9BGHLV27-10
Sample_IDBGHLV27-9BGHLV27-10
Sample Name
Sample Name
RBPPRRC2CPRRC2C
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20772078




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database