Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
PRRC2C
shRNA
in HepG2
Batch: BGHLV27
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV27-9
BGHLV27-10
idx
629
630
TRCN#_or_BGC#
TRCN0000141560
TRCN0000141560
shRNA_or_gRNA_sequence
CCTGGATGAATGAGCAGATAA
CCTGGATGAATGAGCAGATAA
PAM
Name
BAT2L2/PRRC2C
BAT2L2/PRRC2C
Sample_ID
BGHLV27-9
BGHLV27-10
transduction_Date
6/9/2015
6/9/2015
days
RBP_name
PRRC2C
PRRC2C
qPCR_result
57.5
48.9
Ave_qPCR
53.2
RT-qPCR_primer-F
tgattgcaaccacaggaaaa
RT-qPCR_primer-R
ctaccagcgattggaggtgt
protein_conc
4464
4795
WB_result
0.0
0.0
Ave_WB
0.0
WB_DONE_date
9/2/2015
MW
317kDa
IP
1IP
1IP
antibody_Cat#
A303-315A
A303-315A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
40
0
Rep2_TPM
36.9
0
Action
Library_start_date
repeat_library
Note
ID
2720
2721
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV27-9
BGHLV27-10
Sample_ID
BGHLV27-9
BGHLV27-10
Sample Name
Sample Name
RBP
PRRC2C
PRRC2C
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2077
2078
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back