AKAP8L      shRNA in HepG2      Batch: BGHLV27

Experiment Information (Status: NotSatisfied)
BGHLV27-7BGHLV27-8
idx627628
TRCN#_or_BGC#TRCN0000038002>TRCN0000038002
shRNA_or_gRNA_sequenceCCGCAGTATTCTCAACAACAACCGCAGTATTCTCAACAACAA
PAM
NameAKAP8LAKAP8L
Sample_IDBGHLV27-7BGHLV27-8
transduction_Date6/9/20156/9/2015
days
RBP_nameAKAP8LAKAP8L
qPCR_result38.53.0
Ave_qPCR20.7
RT-qPCR_primer-Fcctcttcattcccatgcagt
RT-qPCR_primer-Rtgagggaggacttcttggac
protein_conc38834391
WB_result43.640.5
Ave_WB42.1
WB_DONE_date9/2/2015
MW72kDa
IP1IP1IP
antibody_Cat#GTX115831GTX115831
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM36.10
Rep2_TPM53.20
Action
Library_start_date
repeat_library
Note
ID27182719




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV27-7BGHLV27-8
Sample_IDBGHLV27-7BGHLV27-8
Sample Name
Sample Name
RBPAKAP8LAKAP8L
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20752076




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database