SF3A3      shRNA in HepG2      Batch: BGHLV27

Experiment Information (Status: NotSatisfied)
BGHLV27-49BGHLV27-50
idx669670
TRCN#_or_BGC#TRCN0000000054TRCN0000000054
shRNA_or_gRNA_sequenceCATGTTCTCCAATCCCAGGTACATGTTCTCCAATCCCAGGTA
PAM
NameSF3A3-54SF3A3-54
Sample_IDBGHLV27-49BGHLV27-50
transduction_Date6/9/20156/9/2015
days
RBP_nameSF3A3SF3A3
qPCR_result8.20.0
Ave_qPCR4.1
RT-qPCR_primer-Fcatgaggtgtttgggcatc
RT-qPCR_primer-Ratttcagtttggcccacaag
protein_conc43273682
WB_result
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#A302-506AGTX118225
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM34.20
Rep2_TPM33.30
Action
Library_start_date
repeat_library
Note
ID27602761




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV27-49BGHLV27-50
Sample_IDBGHLV27-49BGHLV27-50
Sample Name
Sample Name
RBPSF3A3SF3A3
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID21072108




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database