Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
MSI2
shRNA
in HepG2
Batch: BGHLV27
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV27-35
BGHLV27-36
idx
655
656
TRCN#_or_BGC#
TRCN0000062812
TRCN0000062812
shRNA_or_gRNA_sequence
AGATAGCCTTAGAGACTATTT
AGATAGCCTTAGAGACTATTT
PAM
Name
MSI2
MSI2
Sample_ID
BGHLV27-35
BGHLV27-36
transduction_Date
6/9/2015
6/9/2015
days
RBP_name
MSI2
MSI2
qPCR_result
8.0
16.9
Ave_qPCR
12.5
RT-qPCR_primer-F
ATTGAGCAGGTGCTTTCGTT
RT-qPCR_primer-R
CTCAGAAACTTCGCCCAGTC
protein_conc
3831
3916
WB_result
Ave_WB
WB_DONE_date
MW
IP
1MB
1MB
antibody_Cat#
GTX117808
GTX117808
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
26.7
0
Rep2_TPM
29.8
0
Action
Library_start_date
repeat_library
Note
ID
2746
2747
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV27-35
BGHLV27-36
Sample_ID
BGHLV27-35
BGHLV27-36
Sample Name
Sample Name
RBP
MSI2
MSI2
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2099
2100
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back