MSI2      shRNA in HepG2      Batch: BGHLV27

Experiment Information (Status: NotSatisfied)
BGHLV27-35BGHLV27-36
idx655656
TRCN#_or_BGC#TRCN0000062812TRCN0000062812
shRNA_or_gRNA_sequenceAGATAGCCTTAGAGACTATTTAGATAGCCTTAGAGACTATTT
PAM
NameMSI2MSI2
Sample_IDBGHLV27-35BGHLV27-36
transduction_Date6/9/20156/9/2015
days
RBP_nameMSI2MSI2
qPCR_result8.016.9
Ave_qPCR12.5
RT-qPCR_primer-FATTGAGCAGGTGCTTTCGTT
RT-qPCR_primer-RCTCAGAAACTTCGCCCAGTC
protein_conc38313916
WB_result
Ave_WB
WB_DONE_date
MW
IP1MB1MB
antibody_Cat#GTX117808GTX117808
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM26.70
Rep2_TPM29.80
Action
Library_start_date
repeat_library
Note
ID27462747




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV27-35BGHLV27-36
Sample_IDBGHLV27-35BGHLV27-36
Sample Name
Sample Name
RBPMSI2MSI2
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20992100




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database