ACO1      shRNA in HepG2      Batch: BGHLV27

Experiment Information (Status: NotSatisfied)
BGHLV27-3BGHLV27-4
idx623624
TRCN#_or_BGC#TRCN0000056557TRCN0000056557
shRNA_or_gRNA_sequenceCCTGCTGATCTTGTAATAGATCCTGCTGATCTTGTAATAGAT
PAM
NameACO1ACO1
Sample_IDBGHLV27-3BGHLV27-4
transduction_Date6/9/20156/9/2015
days
RBP_nameACO1ACO1
qPCR_result25.843.9
Ave_qPCR34.9
RT-qPCR_primer-Fgagccattgggagtaaatgc
RT-qPCR_primer-Rtgacatactgacgctccactg
protein_conc45854664
WB_result
Ave_WB
WB_DONE_date
MW
IP1MW1MW
antibody_Cat#RN036PWRN036PW
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID27142715




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV27-3BGHLV27-4
Sample_IDBGHLV27-3BGHLV27-4
Sample Name
Sample Name
RBPACO1ACO1
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20732074




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database