SF3A3      shRNA in HepG2      Batch: BGHLV26

Experiment Information (Status: NotSatisfied)
BGHLV26-53BGHLV26-54
idx609610
TRCN#_or_BGC#TRCN0000000055TRCN0000000055
shRNA_or_gRNA_sequenceTGGCCTAAATATCAACTACAATGGCCTAAATATCAACTACAA
PAM
NameSF3A3SF3A3
Sample_IDBGHLV26-53BGHLV26-54
transduction_Date5/25/20155/25/2015
days
RBP_nameSF3A3SF3A3
qPCR_result0.00.0
Ave_qPCR0.0
RT-qPCR_primer-Fcatgaggtgtttgggcatc
RT-qPCR_primer-Ratttcagtttggcccacaag
protein_conc34903557
WB_resultredo transfectionredo transfection
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#A302-506GTX118225
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM34.20
Rep2_TPM33.30
Action
Library_start_date
repeat_library
Note
ID27002701




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV26-53BGHLV26-54
Sample_IDBGHLV26-53BGHLV26-54
Sample Name
Sample Name
RBPSF3A3SF3A3
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20672068




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database