DROSHA      shRNA in HepG2      Batch: BGHLV26

Experiment Information (Status: NotSatisfied)
BGHLV26-45BGHLV26-46
idx601602
TRCN#_or_BGC#TRCN0000022250TRCN0000022250
shRNA_or_gRNA_sequenceCGAAGCTCTTTGGTGAATAATCGAAGCTCTTTGGTGAATAAT
PAM
NameRNASENRNASEN
Sample_IDBGHLV26-45BGHLV26-46
transduction_Date5/25/20155/25/2015
days
RBP_nameDROSHADROSHA
qPCR_result49.968.1
Ave_qPCR59.0
RT-qPCR_primer-Faggccagatgaatgatggac
RT-qPCR_primer-Rcttgatggcctcttctccag
protein_conc34453232
WB_resultno clear band
Ave_WBno clear band
WB_DONE_date9/2/2015
MW159kDa
IP1IP1IP
antibody_Cat#A301-886AA301-886A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM140
Rep2_TPM14.50
Action
Library_start_date
repeat_library
Note
ID26882689




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV26-45BGHLV26-46
Sample_IDBGHLV26-45BGHLV26-46
Sample Name
Sample Name
RBPRNASENRNASEN
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20612062




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database