Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
AUH
shRNA
in HepG2
Batch: BGHLV26
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV26-3
BGHLV26-4
idx
557
558
TRCN#_or_BGC#
TRCN0000052452
TRCN0000052452
shRNA_or_gRNA_sequence
GATAAGAAAGTACGGACCATA
GATAAGAAAGTACGGACCATA
PAM
Name
AUH
AUH
Sample_ID
BGHLV26-3
BGHLV26-4
transduction_Date
5/25/2015
5/25/2015
days
RBP_name
AUH
AUH
qPCR_result
23.4
0.0
Ave_qPCR
11.7
RT-qPCR_primer-F
aaaaggggctacagctctga
RT-qPCR_primer-R
attccaagcaccacaattcc
protein_conc
5166
4426
WB_result
redo transfection
redo transfection
Ave_WB
WB_DONE_date
MW
IP
1IP
1IP
antibody_Cat#
RN037P
RN037P
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
2642
2643
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV26-3
BGHLV26-4
Sample_ID
BGHLV26-3
BGHLV26-4
Sample Name
Sample Name
RBP
AUH
AUH
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2031
2032
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back