NFX1      shRNA in HepG2      Batch: BGHLV26

Experiment Information (Status: NotSatisfied)
BGHLV26-25BGHLV26-26
idx581582
TRCN#_or_BGC#TRCN0000014904TRCN0000014904
shRNA_or_gRNA_sequenceGCAGAAATGAAATTCCACATAGCAGAAATGAAATTCCACATA
PAM
NameNFX1NFX1
Sample_IDBGHLV26-25BGHLV26-26
transduction_Date5/25/20155/25/2015
days
RBP_nameNFX1NFX1
qPCR_result59.557.1
Ave_qPCR58.3
RT-qPCR_primer-Fctgcccacattcctgtaacc
RT-qPCR_primer-Rtggttcgtccacattcacat
protein_conc61615842
WB_result25.012.7
Ave_WB18.8
WB_DONE_date9/2/2015
MW124kDa
IP11
antibody_Cat#A302-914AA302-914A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM8.10
Rep2_TPM7.90
Action
Library_start_date
repeat_library
Note
ID26662667




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV26-25BGHLV26-26
Sample_IDBGHLV26-25BGHLV26-26
Sample Name
Sample Name
RBPNFX1NFX1
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20512052




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database