Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
FXR2
shRNA
in HepG2
Batch: BGHLV26
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV26-15
BGHLV26-16
idx
569
570
TRCN#_or_BGC#
TRCN0000013456
TRCN0000013456
shRNA_or_gRNA_sequence
CGAGATACAATTCTTCATCTA
CGAGATACAATTCTTCATCTA
PAM
Name
FXR2
FXR2
Sample_ID
BGHLV26-15
BGHLV26-16
transduction_Date
5/25/2015
5/25/2015
days
RBP_name
FXR2
FXR2
qPCR_result
48.9
31.4
Ave_qPCR
40.1
RT-qPCR_primer-F
accaaaggcagcttcttcaa
RT-qPCR_primer-R
ccagggctttcttgaactctt
protein_conc
4371
4456
WB_result
Ave_WB
WB_DONE_date
MW
IP
1
1
antibody_Cat#
A303-894A
A303-894A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
3.6
0
Rep2_TPM
5.1
0
Action
Library_start_date
repeat_library
Note
ID
2654
2655
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV26-15
BGHLV26-16
Sample_ID
BGHLV26-15
BGHLV26-16
Sample Name
Sample Name
RBP
FXR2
FXR2
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2043
2044
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back