Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
XRN1
shRNA
in HepG2
Batch: BGHLV23
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV23-59
BGHLV23-60
idx
551
552
TRCN#_or_BGC#
TRCN0000049673
TRCN0000049673
shRNA_or_gRNA_sequence
CGCATTATTAAACCCAGGAAA
CGCATTATTAAACCCAGGAAA
PAM
Name
XRN1
XRN1
Sample_ID
BGHLV23-59
BGHLV23-60
transduction_Date
10/29/2014
10/29/2014
days
RBP_name
XRN1
XRN1
qPCR_result
16.9
13.8
Ave_qPCR
15.4
RT-qPCR_primer-F
ggtgaaagagcatcagattcc
RT-qPCR_primer-R
tcatcattaggatgggagca
protein_conc
6443
6322
WB_result
redo transfection
redo transfection
Ave_WB
WB_DONE_date
MW
IP
1
1
antibody_Cat#
A300-443A
A300-443A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
4.2
0
Rep2_TPM
3.6
0
Action
Library_start_date
repeat_library
Note
ID
2636
2637
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV23-59
BGHLV23-60
Sample_ID
BGHLV23-59
BGHLV23-60
Sample Name
Sample Name
RBP
XRN1
XRN1
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2027
2028
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back