SRFBP1      shRNA in HepG2      Batch: BGHLV23

Experiment Information (Status: NotSatisfied)
BGHLV23-43BGHLV23-44
idx535536
TRCN#_or_BGC#TRCN0000166862TRCN0000166862
shRNA_or_gRNA_sequenceCCACTCTTTATCTGGATCTAACCACTCTTTATCTGGATCTAA
PAM
NameSRFBP1SRFBP1
Sample_IDBGHLV23-43BGHLV23-44
transduction_Date10/29/201410/29/2014
days
RBP_nameSRFBP1SRFBP1
qPCR_result7.50.0
Ave_qPCR3.8
RT-qPCR_primer-Faaatttcaaagaacaggctcca
RT-qPCR_primer-Rtgattcttgatctgaggctcatt
protein_conc57835696
WB_result
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#A303-044AA303-044A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM5.80
Rep2_TPM4.80
Action
Library_start_date
repeat_library
Note
ID26202621




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV23-43BGHLV23-44
Sample_IDBGHLV23-43BGHLV23-44
Sample Name
Sample Name
RBPSRFBP1SRFBP1
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20192020




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database