RPS11      shRNA in HepG2      Batch: BGHLV23

Experiment Information (Status: NotSatisfied)
BGHLV23-39BGHLV23-40
idx531532
TRCN#_or_BGC#TRCN0000074979TRCN0000074979
shRNA_or_gRNA_sequenceCCGAGACTATCTGCACTACATCCGAGACTATCTGCACTACAT
PAM
NameRPS11RPS11
Sample_IDBGHLV23-39BGHLV23-40
transduction_Date10/29/201410/29/2014
days
RBP_nameRPS11RPS11
qPCR_result73.071.5
Ave_qPCR72.2
RT-qPCR_primer-Fgtacacctgtccccctgct
RT-qPCR_primer-Rgtgaccttgagcacgttgaa
protein_conc43053296
WB_result33.540.6
Ave_WB37.0
WB_DONE_date5/14/2015
MW18kDa
IP11
antibody_Cat#A303-936AA303-936A
Antibody DCC IDENCAB560LKVENCAB560LKV
submitted_to_DCC_date8/6/2015
Rep1_TPM479.80
Rep2_TPM623.50
Action
Library_start_date
repeat_library
Note
ID26162617




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
RPS11Product_ID: A303-936A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RPS11-human
RPS11_Secondary_Western.png<br>Caption: Western blot following shRNA against RPS11 in HepG2 whole cell lysate using RPS11 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different shRNAs against RPS11. RPS11 protein appears as the green band, Tubulin serves as a control and appears in red.
K562_Bethyl_A303-936A_1_RPS11.png<br>Caption: IP-Western Blot analysis of K562 whole cell lysate using RPS11 specific antibody. Lane 1 is 1% of twenty million whole cell lysate input and lane 2 is 25% of IP enrichment using rabbit normal IgG (lanes under 'IgG'). Lane 3 is 1% of twenty million whole cell lysate input and lane 4 is 10% IP enrichment using rabbit polyclonal anti-RPS11 antibody (lanes under 'RPS11').
RPS11-K562-CRISPR.png<br>Caption: Western blot following CRISPR against RPS11 in K562 whole cell lysate using RPS11 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RPS11. RPS11 protein appears as the green arrow, Tubulin serves as a control and appears in red arrow.




Experiment Status
BGHLV23-39BGHLV23-40
Sample_IDBGHLV23-39BGHLV23-40
Sample Name
Sample Name
RBPRPS11RPS11
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20172018




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database