Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
RPS11
shRNA
in HepG2
Batch: BGHLV23
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV23-39
BGHLV23-40
idx
531
532
TRCN#_or_BGC#
TRCN0000074979
TRCN0000074979
shRNA_or_gRNA_sequence
CCGAGACTATCTGCACTACAT
CCGAGACTATCTGCACTACAT
PAM
Name
RPS11
RPS11
Sample_ID
BGHLV23-39
BGHLV23-40
transduction_Date
10/29/2014
10/29/2014
days
RBP_name
RPS11
RPS11
qPCR_result
73.0
71.5
Ave_qPCR
72.2
RT-qPCR_primer-F
gtacacctgtccccctgct
RT-qPCR_primer-R
gtgaccttgagcacgttgaa
protein_conc
4305
3296
WB_result
33.5
40.6
Ave_WB
37.0
WB_DONE_date
5/14/2015
MW
18kDa
IP
1
1
antibody_Cat#
A303-936A
A303-936A
Antibody DCC ID
ENCAB560LKV
ENCAB560LKV
submitted_to_DCC_date
8/6/2015
Rep1_TPM
479.8
0
Rep2_TPM
623.5
0
Action
Library_start_date
repeat_library
Note
ID
2616
2617
Western Blot
RBP
Antibody Info
Primary-HepG2
Secondary-HepG2
Primary-K562
Secondary-K562
Primary-UBERON
Primary-Hela
RPS11
Product_ID:
A303-936A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RPS11-human
Experiment Status
BGHLV23-39
BGHLV23-40
Sample_ID
BGHLV23-39
BGHLV23-40
Sample Name
Sample Name
RBP
RPS11
RPS11
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2017
2018
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back