NXF1      shRNA in HepG2      Batch: BGHLV23

Experiment Information (Status: NotSatisfied)
BGHLV23-27BGHLV23-28
idx519520
TRCN#_or_BGC#TRCN0000007583TRCN0000007583
shRNA_or_gRNA_sequenceGCGGGAATTGGACAAGATAAAGCGGGAATTGGACAAGATAAA
PAM
NameNXF1_83NXF1_83
Sample_IDBGHLV23-27BGHLV23-28
transduction_Date10/29/201410/29/2014
days
RBP_nameNXF1NXF1
qPCR_result24.815.4
Ave_qPCR20.1
RT-qPCR_primer-Fcctgaatcgcagaagctgta
RT-qPCR_primer-Rgcctgtacagcctgttgttg
protein_conc34674860
WB_resultredo transfectionredo transfection
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#RN088PWRN088PW
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM110
Rep2_TPM18.70
Action
Library_start_date
repeat_library
Note
ID26042605




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV23-27BGHLV23-28
Sample_IDBGHLV23-27BGHLV23-28
Sample Name
Sample Name
RBPNXF1NXF1
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID20112012




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database