Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
ZC3H8
shRNA
in HepG2
Batch: BGHLV22
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV22-61
BGHLV22-62
idx
489
490
TRCN#_or_BGC#
TRCN0000158431
TRCN0000158431
shRNA_or_gRNA_sequence
CCTCTTCTGATTGATTGGATT
CCTCTTCTGATTGATTGGATT
PAM
Name
ZC3H8
ZC3H8
Sample_ID
BGHLV22-61
BGHLV22-62
transduction_Date
10/16/2014
10/16/2014
days
RBP_name
ZC3H8
ZC3H8
qPCR_result
33.7
41.3
Ave_qPCR
37.5
RT-qPCR_primer-F
ccctggaaacaaaggatcaa
RT-qPCR_primer-R
tgaatgcctgactcaaatgc
protein_conc
5862
6465
WB_result
redo transfection
redo transfection
Ave_WB
WB_DONE_date
MW
IP
1
1
antibody_Cat#
A303-089A
A303-089A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
19.2
0
Rep2_TPM
17.5
0
Action
Library_start_date
repeat_library
Note
ID
2568
2569
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV22-61
BGHLV22-62
Sample_ID
BGHLV22-61
BGHLV22-62
Sample Name
Sample Name
RBP
ZC3H8
ZC3H8
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
2001
2002
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back