YTHDC2      shRNA in HepG2      Batch: BGHLV22

Experiment Information (Status: NotSatisfied)
BGHLV22-59BGHLV22-60
idx487488
TRCN#_or_BGC#TRCN0000154178TRCN0000154178
shRNA_or_gRNA_sequenceCCCTCGTCACATCTCTTATATCCCTCGTCACATCTCTTATAT
PAM
NameYTHDC2YTHDC2
Sample_IDBGHLV22-59BGHLV22-60
transduction_Date10/16/201410/16/2014
days
RBP_nameYTHDC2YTHDC2
qPCR_result59.559.3
Ave_qPCR59.4
RT-qPCR_primer-FTCCATGGAATGACAACAAGAA
RT-qPCR_primer-RTGGAGCAACTGTTCACCAAC
protein_conc62956380
WB_result27.048.7
Ave_WB37.9
WB_DONE_date6/4/2015
MW160kDa
IP11
antibody_Cat#A303-025AA303-025A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM5.50
Rep2_TPM5.70
Action
Library_start_date
repeat_library
Note
ID25662567




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV22-59BGHLV22-60
Sample_IDBGHLV22-59BGHLV22-60
Sample Name
Sample Name
RBPYTHDC2YTHDC2
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID19992000




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database