Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
AGO2
shRNA
in HepG2
Batch: BGHLV22
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV22-11
BGHLV22-12
idx
439
440
TRCN#_or_BGC#
TRCN0000007864
TRCN0000007864
shRNA_or_gRNA_sequence
CGGCAAGAAGAGATTAGCAAA
CGGCAAGAAGAGATTAGCAAA
PAM
Name
EIF2C2
EIF2C2
Sample_ID
BGHLV22-11
BGHLV22-12
transduction_Date
10/16/2014
10/16/2014
days
RBP_name
AGO2
AGO2
qPCR_result
50.4
37.2
Ave_qPCR
43.8
RT-qPCR_primer-F
CTCACCTGGTGGCCTTCC
RT-qPCR_primer-R
TGGTCTCGCCCGTTACTCT
protein_conc
6522
6566
WB_result
35.7
30.4
Ave_WB
33.1
WB_DONE_date
2/23/16
wes
MW
97kd
IP
Abnova
fu's
antibody_Cat#
H00027161-M01
H00027161-M01
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
4
0
Rep2_TPM
7.3
0
Action
Library_start_date
repeat_library
Note
ID
2512
2513
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV22-11
BGHLV22-12
Sample_ID
BGHLV22-11
BGHLV22-12
Sample Name
Sample Name
RBP
EIF2C2
EIF2C2
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
1981
1982
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back