DGCR8      shRNA in HepG2      Batch: BGHLV20

Experiment Information (Status: NotSatisfied)
BGHLV20-17BGHLV20-18
idx381382
TRCN#_or_BGC#TRCN0000161562TRCN0000161562
shRNA_or_gRNA_sequenceGCATCCCTTGTCTGCATTATAGCATCCCTTGTCTGCATTATA
PAM
NameDGCR8_62DGCR8_62
Sample_IDBGHLV20-17BGHLV20-18
transduction_Date10/2/201410/2/2014
days
RBP_nameDGCR8DGCR8
qPCR_result0.00.0
Ave_qPCR0.0
RT-qPCR_primer-Fccagccaatcagaagctcat
RT-qPCR_primer-Rtactcgtgcaggatgcagac
protein_conc58156311
WB_resultredo transfectionredo transfection
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#A302-468AA302-468A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM5.50
Rep2_TPM6.30
Action
Library_start_date
repeat_library
Note
ID24502451




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV20-17BGHLV20-18
Sample_IDBGHLV20-17BGHLV20-18
Sample Name
Sample Name
RBPDGCR8DGCR8
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID19611962




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database