NUFIP2      shRNA in HepG2      Batch: BGHLV18

Experiment Information (Status: NotSatisfied)
BGHLV18-33BGHLV18-34
idx333334
TRCN#_or_BGC#TRCN0000167110TRCN0000167110
shRNA_or_gRNA_sequenceCGGTTACATATTGGACTTTAACGGTTACATATTGGACTTTAA
PAM
NameNUFIP2NUFIP2
Sample_IDBGHLV18-33BGHLV18-34
transduction_Date8/28/20148/28/2014
days
RBP_nameNUFIP2NUFIP2
qPCR_result49.531.7
Ave_qPCR40.6
RT-qPCR_primer-Ftggaatttgcagaagcaaga
RT-qPCR_primer-Rtctggtccttcattgatctgg
protein_conc00
WB_result
Ave_WB
WB_DONE_date
MW
IP11
antibody_Cat#A301-599AA301-599A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID24022403




Western Blot
Western Blot info was not avaliable




Experiment Status
BGHLV18-33BGHLV18-34
Sample_IDBGHLV18-33BGHLV18-34
Sample Name
Sample Name
RBPNUFIP2NUFIP2
Cell_LineHepG2HepG2
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2019-06-262019-06-26
ProjectENCODE3ENCODE3
Note
ID19411942




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database