Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
LARP4
shRNA
in HepG2
Batch: BGHLV18
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGHLV18-17
BGHLV18-18
idx
317
318
TRCN#_or_BGC#
TRCN0000161967
TRCN0000161967
shRNA_or_gRNA_sequence
GCACACAATAGCAACTGGTAT
GCACACAATAGCAACTGGTAT
PAM
Name
LARP4
LARP4
Sample_ID
BGHLV18-17
BGHLV18-18
transduction_Date
8/28/2014
8/28/2014
days
RBP_name
LARP4
LARP4
qPCR_result
44.4
29.2
Ave_qPCR
36.8
RT-qPCR_primer-F
aaagtgaaaactgccccaaa
RT-qPCR_primer-R
aagcctgttgtgcatctgtg
protein_conc
0
0
WB_result
Ave_WB
WB_DONE_date
MW
IP
1
1
antibody_Cat#
A303-900A
A303-900A
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
7.3
0
Rep2_TPM
6.9
0
Action
Library_start_date
repeat_library
Note
ID
2386
2387
Western Blot
Western Blot info was not avaliable
Experiment Status
BGHLV18-17
BGHLV18-18
Sample_ID
BGHLV18-17
BGHLV18-18
Sample Name
Sample Name
RBP
LARP4
LARP4
Cell_Line
HepG2
HepG2
Exp UID
Status
NotSatisfied
NotSatisfied
Status_date
2019-06-26
2019-06-26
Project
ENCODE3
ENCODE3
Note
ID
1935
1936
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back