RPS15      CRISPR in K562      Control: NT-BGKcLV44-1,NT-BGKcLV44-2

General Information
RBPRPS15
Cell_LineK562
MethodCRISPR
Exp_NameRPS15-BGKcLV44-K562
ENCODE_series_ID
Batch_IDBGKcLV44
Pool IDPool-241015
Local_Set_Nameset75
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1RPS15-BGKcLV44-57
Rep2RPS15-BGKcLV44-58
CN1NT-BGKcLV44-1
CN2NT-BGKcLV44-2
Rep1_qPCR53.2
Rep2_qPCR50.6
Rep1_WB62.7
Rep2_WB52.7
Antibody Cat#A305-041A
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1607




Experiment Information (Status: Submitting)
BGKcLV44-57BGKcLV44-58
idx00
TRCN#_or_BGC#BGC#0000813BGC#0000813
shRNA_or_gRNA_sequenceACAAGCCCGTAAAGCATGGCACAAGCCCGTAAAGCATGGC
PAMCGGCGG
NameRPS15-64RPS15-64
Sample_IDBGKcLV44-57BGKcLV44-58
transduction_Date7/30/247/30/24
daysD6D6
RBP_nameRPS15RPS15
qPCR_result53.250.6
Ave_qPCR51.9
RT-qPCR_primer-Fgaagtggtgaagacgcacct
RT-qPCR_primer-Rcaggtagtggccgatcatct
protein_conc42274164
WB_result62.752.7
Ave_WB57.7
WB_DONE_date8/19/24
MW17KD
IP
antibody_Cat#A305-041Alot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID59535954




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
RPS15Product_ID: A305-041A
Lot_ID: 1
Source: Bethyl Labs
Target Name: RPS15-human
RPS15-HEPG2-CRISPR-A305-041A.png<br>Caption: Western blot following CRISPR against RPS15 in HepG2 whole cell lysate using RPS15 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RPS15. RPS15 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
Bethyl_A305-041A_1_RPS15.png<br>Caption: IP-WB analysis of K562 whole cell lysate using the RPS15 specific antibody, A305-041A. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the RPS15-specific antibody, A305-041A. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
RPS15-K562-CRISPR-A305-041A.png<br>Caption: Western blot following CRISPR against RPS15 in K562 whole cell lysate using RPS15 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against RPS15. RPS15 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV44-57BGKcLV44-58
Sample_IDBGKcLV44-57BGKcLV44-58
Sample Name
Sample NameRPS15-BGKcLV44-57RPS15-BGKcLV44-58
RBPRPS15RPS15
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-112025-02-11
ProjectENCORE2ENCORE2
Note
ID1360613607




Library-Prep Information
BGKcLV44-57BGKcLV44-58
Sample #3536
Sample NameRPS15-BGKcLV44-57RPS15-BGKcLV44-58
Sample_Name_Alias
Index Well PositionC10D10
Index_tableIDT_UniqueDualIndex_96_V2IDT_UniqueDualIndex_96_V2
LibPrep_date2024-10-102024-10-10
Lib_IDLib-241010Lib-241010
Tecan_Location
Tecan
Tecan_date
Size_bp293291
Peak_Molarity97.5085.50
libSampleQC_DNA_WellDNA_Library_set75/set1/C10.pngDNA_Library_set75/set1/D10.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set75/set1/C4.pngRNA_Library_set75/set1/D4.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-10-152024-10-15
Sample_IDBGKcLV44-57BGKcLV44-58
RBPRPS15RPS15
Batch_IDBGKcLV44BGKcLV44
WB_result62.70052.700
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID45944595




Sequencing Information
BGKcLV44-57BGKcLV44-58
Sample_IDBGKcLV44-57BGKcLV44-58
Sample NameRPS15-BGKcLV44-57RPS15-BGKcLV44-58
Pool IDPool-241015Pool-241015
LocalServer_folderset75set75
total_reads51,143,41450,179,129
total_aligned_reads48,845,18147,968,322
unique_aligned_reads45,389,47044,094,324
percent_uniqueAligned0.887490.87874
correlation_replicates0.9926280.992628
spikein_reads69,66654,708
percent_spikeins0.001360.00109
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID33053306




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
RPS15-BGKcLV44-57_S27_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3305NovaSeq6000100paired-ended1NT-BGKcLV44-1_S1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230964
RPS15-BGKcLV44-57_S27_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3305NovaSeq6000100paired-ended2NT-BGKcLV44-1_S1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231006
RPS15-BGKcLV44-57_Aligned.sortedByCoord.out.bamENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3305GRCh38V40RPS15-BGKcLV44-57_S27_L001_R1_001.filtered.trimmed.paired.fastq.gz,RPS15-BGKcLV44-57_S27_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231048
RPS15-BGKcLV44-57_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3305GRCh38V40RPS15-BGKcLV44-57_Aligned.sortedByCoord.out.bamENCORE231090
RPS15-BGKcLV44-57_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3305GRCh38V40RPS15-BGKcLV44-57_Aligned.sortedByCoord.out.bamENCORE231132
RPS15-BGKcLV44-57_Signal.Unique.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3305GRCh38V40RPS15-BGKcLV44-57_Aligned.sortedByCoord.out.bamENCORE231174
RPS15-BGKcLV44-57_Signal.Unique.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3305GRCh38V40RPS15-BGKcLV44-57_Aligned.sortedByCoord.out.bamENCORE231216
RPS15-BGKcLV44-57_quant.sfENCODE_DATA/set75/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3305GRCh38V40RPS15-BGKcLV44-57_S27_L001_R1_001.filtered.trimmed.paired.fastq.gz,RPS15-BGKcLV44-57_S27_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231258
RPS15-BGKcLV44-58_S28_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3306NovaSeq6000100paired-ended1NT-BGKcLV44-1_S1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230965
RPS15-BGKcLV44-58_S28_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set75/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3306NovaSeq6000100paired-ended2NT-BGKcLV44-1_S1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV44-2_S2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231007
RPS15-BGKcLV44-58_Aligned.sortedByCoord.out.bamENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3306GRCh38V40RPS15-BGKcLV44-58_S28_L001_R1_001.filtered.trimmed.paired.fastq.gz,RPS15-BGKcLV44-58_S28_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231049
RPS15-BGKcLV44-58_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3306GRCh38V40RPS15-BGKcLV44-58_Aligned.sortedByCoord.out.bamENCORE231091
RPS15-BGKcLV44-58_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3306GRCh38V40RPS15-BGKcLV44-58_Aligned.sortedByCoord.out.bamENCORE231133
RPS15-BGKcLV44-58_Signal.Unique.strand-.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3306GRCh38V40RPS15-BGKcLV44-58_Aligned.sortedByCoord.out.bamENCORE231175
RPS15-BGKcLV44-58_Signal.Unique.strand+.bwENCODE_DATA/set75/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3306GRCh38V40RPS15-BGKcLV44-58_Aligned.sortedByCoord.out.bamENCORE231217
RPS15-BGKcLV44-58_quant.sfENCODE_DATA/set75/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3306GRCh38V40RPS15-BGKcLV44-58_S28_L001_R1_001.filtered.trimmed.paired.fastq.gz,RPS15-BGKcLV44-58_S28_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231259