DEK      CRISPR in K562      Control: NT-BGKcLV44-1,NT-BGKcLV44-2

General Information
RBPDEK
Cell_LineK562
MethodCRISPR
Exp_NameDEK-BGKcLV44-K562
ENCODE_series_ID
Batch_IDBGKcLV44
Pool IDPool-241015
Local_Set_Nameset75
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1DEK-BGKcLV44-13
Rep2DEK-BGKcLV44-14
CN1NT-BGKcLV44-1
CN2NT-BGKcLV44-2
Rep1_qPCR58.9
Rep2_qPCR59.4
Rep1_WB72.0
Rep2_WB76.3
Antibody Cat#720215
Antibody Lot#SD249202
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1597




Experiment Information (Status: NotSatisfied)
BGKcLV44-15BGKcLV44-16
idx00
TRCN#_or_BGC#BGC#0000311BGC#0000311
shRNA_or_gRNA_sequenceTCGGGTTCTTTCTCGGACGCTCGGGTTCTTTCTCGGACGC
PAMgggggg
NameDEK_98DEK_98
Sample_IDBGKcLV44-15BGKcLV44-16
transduction_Date7/30/247/30/24
daysD6D6
RBP_nameDEKDEK
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc51784710
WB_result0.00.0
Ave_WB
WB_DONE_date8/7/24
MW
IP
antibody_Cat#720215SD249202
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID59055906




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV44-15BGKcLV44-16
Sample_IDBGKcLV44-15BGKcLV44-16
Sample Name
Sample Name
RBPDEKDEK
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2024-10-082024-10-08
ProjectENCORE2ENCORE2
Note
ID1362813629




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database