USP15      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPUSP15
Cell_LineK562
MethodCRISPR
Exp_NameUSP15-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1USP15-BGKcLV42-99
Rep2USP15-BGKcLV42-100
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR44.5
Rep2_qPCR40.7
Rep1_WB90.5
Rep2_WB91.8
Antibody Cat#66310S
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1565




Experiment Information (Status: Submitting)
BGKcLV42-99BGKcLV42-100
idx00
TRCN#_or_BGC#BGC#0001200BGC#0001200
shRNA_or_gRNA_sequenceTGAACCAGCGACTATCGACTTGAACCAGCGACTATCGACT
PAMAGGAGG
NameUSP15_96USP15_96
Sample_IDBGKcLV42-99BGKcLV42-100
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameUSP15USP15
qPCR_result44.540.7
Ave_qPCR42.6
RT-qPCR_primer-Ftgtgtatcctggacccattg
RT-qPCR_primer-Raagtgactgggcatcaccat
protein_conc25342730
WB_result90.591.8
Ave_WB91.2
WB_DONE_date5/10/24
MW120kd
IP
antibody_Cat#66310Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID58805881




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
USP15Product_ID: 66310S
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: USP15-human
USP15-HEPG2-CRISPR-66310S.png<br>Caption: Western blot following CRISPR against USP15 in HepG2 whole cell lysate using USP15 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against USP15. USP15 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
CST_66310S_1_USP15.png<br>Caption: IP-WB analysis of 66310S whole cell lysate using the USP15 specific antibody, 66310S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the USP15-specific antibody, 66310S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
USP15-K562-CRISPR-66310S.png<br>Caption: Western blot following CRISPR against USP15 in K562 whole cell lysate using USP15 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against USP15. USP15 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-99BGKcLV42-100
Sample_IDBGKcLV42-99BGKcLV42-100
Sample Name
Sample NameUSP15-BGKcLV42-99USP15-BGKcLV42-100
RBPUSP15USP15
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1312413125




Library-Prep Information
BGKcLV42-99BGKcLV42-100
Sample #8182
Sample NameUSP15-BGKcLV42-99USP15-BGKcLV42-100
Sample_Name_Alias
Index Well PositionA11B11
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp300315
Peak_Molarity90.2090.10
libSampleQC_DNA_WellDNA_Library_set73/set1/A11.pngDNA_Library_set73/set1/B11.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set73/set1/A11.pngRNA_Library_set73/set1/B11.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-99BGKcLV42-100
RBPUSP15USP15
Batch_IDBGKcLV42BGKcLV42
WB_result90.50091.800
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID43504351




Sequencing Information
BGKcLV42-99BGKcLV42-100
Sample_IDBGKcLV42-99BGKcLV42-100
Sample NameUSP15-BGKcLV42-99USP15-BGKcLV42-100
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads40,705,41045,447,231
total_aligned_reads34,500,52542,879,019
unique_aligned_reads31,871,61039,754,872
percent_uniqueAligned0.782980.87475
correlation_replicates0.9971310.997131
spikein_reads5,2961,130
percent_spikeins0.000130.00002
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID32173218




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
USP15-BGKcLV42-99_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3217NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230421
USP15-BGKcLV42-99_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3217NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230511
USP15-BGKcLV42-99_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3217GRCh38V40USP15-BGKcLV42-99_L001_R1_001.filtered.trimmed.paired.fastq.gz,USP15-BGKcLV42-99_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231353
USP15-BGKcLV42-99_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3217GRCh38V40USP15-BGKcLV42-99_Aligned.sortedByCoord.out.bamENCORE231443
USP15-BGKcLV42-99_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3217GRCh38V40USP15-BGKcLV42-99_Aligned.sortedByCoord.out.bamENCORE231533
USP15-BGKcLV42-99_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3217GRCh38V40USP15-BGKcLV42-99_Aligned.sortedByCoord.out.bamENCORE231623
USP15-BGKcLV42-99_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3217GRCh38V40USP15-BGKcLV42-99_Aligned.sortedByCoord.out.bamENCORE231713
USP15-BGKcLV42-99_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3217GRCh38V40USP15-BGKcLV42-99_L001_R1_001.filtered.trimmed.paired.fastq.gz,USP15-BGKcLV42-99_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231803
USP15-BGKcLV42-100_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3218NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230420
USP15-BGKcLV42-100_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3218NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230510
USP15-BGKcLV42-100_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3218GRCh38V40USP15-BGKcLV42-100_L001_R1_001.filtered.trimmed.paired.fastq.gz,USP15-BGKcLV42-100_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231352
USP15-BGKcLV42-100_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3218GRCh38V40USP15-BGKcLV42-100_Aligned.sortedByCoord.out.bamENCORE231442
USP15-BGKcLV42-100_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3218GRCh38V40USP15-BGKcLV42-100_Aligned.sortedByCoord.out.bamENCORE231532
USP15-BGKcLV42-100_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3218GRCh38V40USP15-BGKcLV42-100_Aligned.sortedByCoord.out.bamENCORE231622
USP15-BGKcLV42-100_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3218GRCh38V40USP15-BGKcLV42-100_Aligned.sortedByCoord.out.bamENCORE231712
USP15-BGKcLV42-100_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3218GRCh38V40USP15-BGKcLV42-100_L001_R1_001.filtered.trimmed.paired.fastq.gz,USP15-BGKcLV42-100_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231802