BCAT2      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPBCAT2
Cell_LineK562
MethodCRISPR
Exp_NameBCAT2-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1BCAT2-BGKcLV42-9
Rep2BCAT2-BGKcLV42-10
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR39.3
Rep2_qPCR36.6
Rep1_WB93.2
Rep2_WB95.0
Antibody Cat#79764S
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1528




Experiment Information (Status: Submitting)
BGKcLV42-9BGKcLV42-10
idx00
TRCN#_or_BGC#BGC#0001112BGC#0001112
shRNA_or_gRNA_sequenceATTTACCGACCACATGCTGAATTTACCGACCACATGCTGA
PAMTGGTGG
NameBCAT2_83BCAT2_83
Sample_IDBGKcLV42-9BGKcLV42-10
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameBCAT2BCAT2
qPCR_result39.336.6
Ave_qPCR37.9
RT-qPCR_primer-Fccgctgaatggtgttatcct
RT-qPCR_primer-Rcaactgcttcatggtgatcg
protein_conc24072852
WB_result93.295.0
Ave_WB94.1
WB_DONE_date5/2/24
MW39kd
IP
antibody_Cat#79764Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID57745775




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
BCAT2Product_ID: 79764S
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: BCAT2-human
CST_79764S_1_BCAT2.png<br>Caption: IP-WB analysis of 79764S whole cell lysate using the BCAT2 specific antibody, 79764S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the BCAT2-specific antibody, 79764S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
BCAT2-K562-CRISPR-79764S.png<br>Caption: Western blot following CRISPR against BCAT2 in K562 whole cell lysate using BCAT2 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against BCAT2. BCAT2 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-9BGKcLV42-10
Sample_IDBGKcLV42-9BGKcLV42-10
Sample Name
Sample NameBCAT2-BGKcLV42-9BCAT2-BGKcLV42-10
RBPBCAT2BCAT2
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1305013051




Library-Prep Information
BGKcLV42-9BGKcLV42-10
Sample #78
Sample NameBCAT2-BGKcLV42-9BCAT2-BGKcLV42-10
Sample_Name_Alias
Index Well PositionG01H01
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp292300
Peak_Molarity47.1025.00
libSampleQC_DNA_WellDNA_Library_set73/set1/G1.pngDNA_Library_set73/set1/H1.png
RIN10.09.9
libSample_RNA_WellRNA_Library_set73/set1/G1.pngRNA_Library_set73/set1/H1.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-9BGKcLV42-10
RBPBCAT2BCAT2
Batch_IDBGKcLV42BGKcLV42
WB_result93.20095.000
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID42764277




Sequencing Information
BGKcLV42-9BGKcLV42-10
Sample_IDBGKcLV42-9BGKcLV42-10
Sample NameBCAT2-BGKcLV42-9BCAT2-BGKcLV42-10
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads70,066,168101,605,100
total_aligned_reads58,903,98893,557,518
unique_aligned_reads54,236,30686,208,853
percent_uniqueAligned0.774070.84847
correlation_replicates0.9959560.995956
spikein_reads7,43412,456
percent_spikeins0.000110.00012
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID31433144




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
BCAT2-BGKcLV42-9_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3143NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230345
BCAT2-BGKcLV42-9_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3143NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230435
BCAT2-BGKcLV42-9_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3143GRCh38V40BCAT2-BGKcLV42-9_L001_R1_001.filtered.trimmed.paired.fastq.gz,BCAT2-BGKcLV42-9_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231277
BCAT2-BGKcLV42-9_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3143GRCh38V40BCAT2-BGKcLV42-9_Aligned.sortedByCoord.out.bamENCORE231367
BCAT2-BGKcLV42-9_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3143GRCh38V40BCAT2-BGKcLV42-9_Aligned.sortedByCoord.out.bamENCORE231457
BCAT2-BGKcLV42-9_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3143GRCh38V40BCAT2-BGKcLV42-9_Aligned.sortedByCoord.out.bamENCORE231547
BCAT2-BGKcLV42-9_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3143GRCh38V40BCAT2-BGKcLV42-9_Aligned.sortedByCoord.out.bamENCORE231637
BCAT2-BGKcLV42-9_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3143GRCh38V40BCAT2-BGKcLV42-9_L001_R1_001.filtered.trimmed.paired.fastq.gz,BCAT2-BGKcLV42-9_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231727
BCAT2-BGKcLV42-10_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3144NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230344
BCAT2-BGKcLV42-10_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3144NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230434
BCAT2-BGKcLV42-10_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3144GRCh38V40BCAT2-BGKcLV42-10_L001_R1_001.filtered.trimmed.paired.fastq.gz,BCAT2-BGKcLV42-10_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231276
BCAT2-BGKcLV42-10_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3144GRCh38V40BCAT2-BGKcLV42-10_Aligned.sortedByCoord.out.bamENCORE231366
BCAT2-BGKcLV42-10_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3144GRCh38V40BCAT2-BGKcLV42-10_Aligned.sortedByCoord.out.bamENCORE231456
BCAT2-BGKcLV42-10_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3144GRCh38V40BCAT2-BGKcLV42-10_Aligned.sortedByCoord.out.bamENCORE231546
BCAT2-BGKcLV42-10_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3144GRCh38V40BCAT2-BGKcLV42-10_Aligned.sortedByCoord.out.bamENCORE231636
BCAT2-BGKcLV42-10_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3144GRCh38V40BCAT2-BGKcLV42-10_L001_R1_001.filtered.trimmed.paired.fastq.gz,BCAT2-BGKcLV42-10_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231726