ADD1      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPADD1
Cell_LineK562
MethodCRISPR
Exp_NameADD1-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1ADD1-BGKcLV42-3
Rep2ADD1-BGKcLV42-4
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR38.0
Rep2_qPCR0.0
Rep1_WB53.4
Rep2_WB57.8
Antibody Cat#70174S
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1526




Experiment Information (Status: Submitting)
BGKcLV42-3BGKcLV42-3BGKcLV42-4BGKcLV42-4
idx0000
TRCN#_or_BGC#BGC#0001106BGC#0001106BGC#0001106BGC#0001106
shRNA_or_gRNA_sequenceTGGTGATTCTCGTGCTGCGGTGGTGATTCTCGTGCTGCGGTGGTGATTCTCGTGCTGCGGTGGTGATTCTCGTGCTGCGG
PAMTGGTGGTGGTGG
NameADD1_86ADD1_86ADD1_86ADD1_86
Sample_IDBGKcLV42-3BGKcLV42-3BGKcLV42-4BGKcLV42-4
transduction_Date4/23/244/23/244/23/244/23/24
daysD6D6D6D6
RBP_nameADD1ADD1ADD1ADD1
qPCR_result38.038.00.00.0
Ave_qPCR19.019.0
RT-qPCR_primer-Ftctttgggtggtctcagctttctttgggtggtctcagctt
RT-qPCR_primer-Ragaagcccaaaagggacaatagaagcccaaaagggacaat
protein_conc2482248236893689
WB_result53.468.457.879.2
Ave_WB55.6
WB_DONE_date5/2/248/22/24
MW120KD120KD
IP
antibody_Cat#70174SGTX101600lot # 1lot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM0000
Rep2_TPM0000
ActionReadyReady
Library_start_date
repeat_library
Note
ID5766576857675769




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
ADD1Product_ID: 70174S
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: ADD1-human
ADD1-HEPG2-CRISPR-70174S.png<br>Caption: Western blot following CRISPR against ADD1 in HepG2 whole cell lysate using ADD1 specific antibody. Lane 1 is a ladder, lane 2 is HepG2 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against ADD1. ADD1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
CST_70174S_1_ADD1.png<br>Caption: IP-WB analysis of 70174S whole cell lysate using the ADD1 specific antibody, 70174S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the ADD1-specific antibody, 70174S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
ADD1-K562-CRISPR-70174S.png<br>Caption: Western blot following CRISPR against ADD1 in K562 whole cell lysate using ADD1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against ADD1. ADD1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.
ADD1Product_ID: GTX101600
Lot_ID: 39742
Source: GeneTex
Target Name: ADD1-human
ADD1-K562-CRISPR-GTX101600.png<br>Caption: Western blot following CRISPR against ADD1 in K562 whole cell lysate using ADD1 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against ADD1. ADD1 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-3BGKcLV42-4
Sample_IDBGKcLV42-3BGKcLV42-4
Sample Name
Sample NameADD1-BGKcLV42-3ADD1-BGKcLV42-4
RBPADD1ADD1
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1304613047




Library-Prep Information
BGKcLV42-3BGKcLV42-4
Sample #34
Sample NameADD1-BGKcLV42-3ADD1-BGKcLV42-4
Sample_Name_Alias
Index Well PositionC01D01
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp287296
Peak_Molarity67.6095.60
libSampleQC_DNA_WellDNA_Library_set73/set1/C1.pngDNA_Library_set73/set1/D1.png
RIN10.09.9
libSample_RNA_WellRNA_Library_set73/set1/C1.pngRNA_Library_set73/set1/D1.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-3BGKcLV42-4
RBPADD1ADD1
Batch_IDBGKcLV42BGKcLV42
WB_result53.40057.810
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID42724273




Sequencing Information
BGKcLV42-3BGKcLV42-4
Sample_IDBGKcLV42-3BGKcLV42-4
Sample NameADD1-BGKcLV42-3ADD1-BGKcLV42-4
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads37,504,27350,508,829
total_aligned_reads27,892,46237,665,403
unique_aligned_reads25,507,79334,624,044
percent_uniqueAligned0.680130.68550
correlation_replicates0.9609080.960908
spikein_reads5,9141,578
percent_spikeins0.000160.00003
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID31393140




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
ADD1-BGKcLV42-3_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3139NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230340
ADD1-BGKcLV42-3_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3139NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230430
ADD1-BGKcLV42-3_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3139GRCh38V40ADD1-BGKcLV42-3_L001_R1_001.filtered.trimmed.paired.fastq.gz,ADD1-BGKcLV42-3_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231272
ADD1-BGKcLV42-3_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3139GRCh38V40ADD1-BGKcLV42-3_Aligned.sortedByCoord.out.bamENCORE231362
ADD1-BGKcLV42-3_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3139GRCh38V40ADD1-BGKcLV42-3_Aligned.sortedByCoord.out.bamENCORE231452
ADD1-BGKcLV42-3_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3139GRCh38V40ADD1-BGKcLV42-3_Aligned.sortedByCoord.out.bamENCORE231542
ADD1-BGKcLV42-3_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3139GRCh38V40ADD1-BGKcLV42-3_Aligned.sortedByCoord.out.bamENCORE231632
ADD1-BGKcLV42-3_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3139GRCh38V40ADD1-BGKcLV42-3_L001_R1_001.filtered.trimmed.paired.fastq.gz,ADD1-BGKcLV42-3_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231722
ADD1-BGKcLV42-4_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3140NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230341
ADD1-BGKcLV42-4_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3140NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230431
ADD1-BGKcLV42-4_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3140GRCh38V40ADD1-BGKcLV42-4_L001_R1_001.filtered.trimmed.paired.fastq.gz,ADD1-BGKcLV42-4_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231273
ADD1-BGKcLV42-4_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3140GRCh38V40ADD1-BGKcLV42-4_Aligned.sortedByCoord.out.bamENCORE231363
ADD1-BGKcLV42-4_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3140GRCh38V40ADD1-BGKcLV42-4_Aligned.sortedByCoord.out.bamENCORE231453
ADD1-BGKcLV42-4_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3140GRCh38V40ADD1-BGKcLV42-4_Aligned.sortedByCoord.out.bamENCORE231543
ADD1-BGKcLV42-4_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3140GRCh38V40ADD1-BGKcLV42-4_Aligned.sortedByCoord.out.bamENCORE231633
ADD1-BGKcLV42-4_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3140GRCh38V40ADD1-BGKcLV42-4_L001_R1_001.filtered.trimmed.paired.fastq.gz,ADD1-BGKcLV42-4_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231723