DHX29      CRISPR in K562      Control: NT-BGKcLV42-1,NT-BGKcLV42-2

General Information
RBPDHX29
Cell_LineK562
MethodCRISPR
Exp_NameDHX29-BGKcLV42-K562
ENCODE_series_ID
Batch_IDBGKcLV42
Pool IDPool-240715
Local_Set_Nameset73
ENCODE_KD_Exp_ID
ENCODE_CN_Exp_ID
Rep1DHX29-BGKcLV42-23
Rep2DHX29-BGKcLV42-24
CN1NT-BGKcLV42-1
CN2NT-BGKcLV42-2
Rep1_qPCR58.0
Rep2_qPCR57.8
Rep1_WB55.7
Rep2_WB53.4
Antibody Cat#5926S
Antibody Lot#lot # 1
Antibody DCC ID
StatusSubmitted
ProjectENCORE2
ID1535




Experiment Information (Status: Submitting)
BGKcLV42-23BGKcLV42-24
idx00
TRCN#_or_BGC#BGC#0001126BGC#0001126
shRNA_or_gRNA_sequenceATAGAATAGCATGCTGAGTGATAGAATAGCATGCTGAGTG
PAMCGGCGG
NameDHX29_57DHX29_57
Sample_IDBGKcLV42-23BGKcLV42-24
transduction_Date4/23/244/23/24
daysD6D6
RBP_nameDHX29DHX29
qPCR_result58.057.8
Ave_qPCR57.9
RT-qPCR_primer-Fcaagctgcagcattcacact
RT-qPCR_primer-Ragtgatacccgtctctgcaa
protein_conc30712558
WB_result55.753.4
Ave_WB54.6
WB_DONE_date5/6/24
MW155KD
IP
antibody_Cat#5926Slot # 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
ActionReadyReady
Library_start_date
repeat_library
Note
ID57965797




Western Blot
RBP Antibody InfoPrimary-HepG2Secondary-HepG2Primary-K562Secondary-K562Primary-UBERONPrimary-Hela
DHX29Product_ID: 5926S
Lot_ID: 1
Source: Cell Signaling Technology
Target Name: DHX29-human
CST_5926S_1_DHX29.png<br>Caption: IP-WB analysis of 5926S whole cell lysate using the DHX29 specific antibody, 5926S. Lanes 1 and 2 are 2.5% of five million whole cell lysate input and 50% of IP enrichment, respectively, using a normal IgG antibody. Lane 3 is 50% of IP enrichment from five million whole cell lysate using the DHX29-specific antibody, 5926S. The same antibody was used to detect protein levels via Western blot. This antibody passes preliminary validation and will be further pursued for secondary validation. *NOTE* Protein sizes are taken from Genecards.org and are only estimates based on sequence. Actual protein size may differ based on protein characteristics and electrophoresis method used.
DHX29-K562-CRISPR-5926S.png<br>Caption: Western blot following CRISPR against DHX29 in K562 whole cell lysate using DHX29 specific antibody. Lane 1 is a ladder, lane 2 is K562 non-targeting control knockdown, lane 3 and 4 are two different CRISPR against DHX29. DHX29 protein appears as the green arrow, Beta-actin serves as a control and appears in red arrow.




Experiment Status
BGKcLV42-23BGKcLV42-24
Sample_IDBGKcLV42-23BGKcLV42-24
Sample Name
Sample NameDHX29-BGKcLV42-23DHX29-BGKcLV42-24
RBPDHX29DHX29
Cell_LineK562K562
Exp UID
StatusSubmittingSubmitting
Status_date2025-02-132025-02-13
ProjectENCORE2ENCORE2
Note
ID1306413065




Library-Prep Information
BGKcLV42-23BGKcLV42-24
Sample #2122
Sample NameDHX29-BGKcLV42-23DHX29-BGKcLV42-24
Sample_Name_Alias
Index Well PositionE03F03
Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
LibPrep_date2024-06-212024-06-21
Lib_IDLib-240621Lib-240621
Tecan_Location
Tecan
Tecan_date
Size_bp289291
Peak_Molarity104.00103.00
libSampleQC_DNA_WellDNA_Library_set73/set1/E3.pngDNA_Library_set73/set1/F3.png
RIN10.010.0
libSample_RNA_WellRNA_Library_set73/set1/E3.pngRNA_Library_set73/set1/F3.png
SampleQC_methodTapeStation_2022TapeStation_2022
SampleQC_date2024-07-152024-07-15
Sample_IDBGKcLV42-23BGKcLV42-24
RBPDHX29DHX29
Batch_IDBGKcLV42BGKcLV42
WB_result55.70053.400
Library DescriptionTruSeq mRNATruSeq mRNA
Repeat_Library_Suffix
Lib_StatusSendToSequenceSendToSequence
ProjectENCORE2ENCORE2
ID42904291




Sequencing Information
BGKcLV42-23BGKcLV42-24
Sample_IDBGKcLV42-23BGKcLV42-24
Sample NameDHX29-BGKcLV42-23DHX29-BGKcLV42-24
Pool IDPool-240715Pool-240715
LocalServer_folderset73set73
total_reads47,212,50736,432,888
total_aligned_reads39,782,37632,804,164
unique_aligned_reads36,582,34830,317,276
percent_uniqueAligned0.774840.83214
correlation_replicates0.9987270.998727
spikein_reads1,9263,626
percent_spikeins0.000040.00010
original_ReadLength101101
QC_StatusSubmittingSubmitting
ID31573158




Data Submission Information
DCC submission information was not avaliable




File Information
file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
DHX29-BGKcLV42-23_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3157NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230358
DHX29-BGKcLV42-23_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3157NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230448
DHX29-BGKcLV42-23_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3157GRCh38V40DHX29-BGKcLV42-23_L001_R1_001.filtered.trimmed.paired.fastq.gz,DHX29-BGKcLV42-23_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231290
DHX29-BGKcLV42-23_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3157GRCh38V40DHX29-BGKcLV42-23_Aligned.sortedByCoord.out.bamENCORE231380
DHX29-BGKcLV42-23_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3157GRCh38V40DHX29-BGKcLV42-23_Aligned.sortedByCoord.out.bamENCORE231470
DHX29-BGKcLV42-23_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3157GRCh38V40DHX29-BGKcLV42-23_Aligned.sortedByCoord.out.bamENCORE231560
DHX29-BGKcLV42-23_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3157GRCh38V40DHX29-BGKcLV42-23_Aligned.sortedByCoord.out.bamENCORE231650
DHX29-BGKcLV42-23_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3157GRCh38V40DHX29-BGKcLV42-23_L001_R1_001.filtered.trimmed.paired.fastq.gz,DHX29-BGKcLV42-23_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231740
DHX29-BGKcLV42-24_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3158NovaSeq6000100paired-ended1NT-BGKcLV42-1_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R1_001.filtered.trimmed.paired.fastq.gzENCORE230359
DHX29-BGKcLV42-24_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set73/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab3158NovaSeq6000100paired-ended2NT-BGKcLV42-1_L001_R2_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV42-2_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE230449
DHX29-BGKcLV42-24_Aligned.sortedByCoord.out.bamENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab3158GRCh38V40DHX29-BGKcLV42-24_L001_R1_001.filtered.trimmed.paired.fastq.gz,DHX29-BGKcLV42-24_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231291
DHX29-BGKcLV42-24_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3158GRCh38V40DHX29-BGKcLV42-24_Aligned.sortedByCoord.out.bamENCORE231381
DHX29-BGKcLV42-24_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab3158GRCh38V40DHX29-BGKcLV42-24_Aligned.sortedByCoord.out.bamENCORE231471
DHX29-BGKcLV42-24_Signal.Unique.strand-.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3158GRCh38V40DHX29-BGKcLV42-24_Aligned.sortedByCoord.out.bamENCORE231561
DHX29-BGKcLV42-24_Signal.Unique.strand+.bwENCODE_DATA/set73/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab3158GRCh38V40DHX29-BGKcLV42-24_Aligned.sortedByCoord.out.bamENCORE231651
DHX29-BGKcLV42-24_quant.sfENCODE_DATA/set73/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab3158GRCh38V40DHX29-BGKcLV42-24_L001_R1_001.filtered.trimmed.paired.fastq.gz,DHX29-BGKcLV42-24_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE231741