Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
SAMHD1
CRISPR
in K562
Control:
NT-BGKcLV33
General Information
Experiment Information
Sequencing Information
Data Submission
Files
General Information
RBP
SAMHD1
Cell_Line
K562
Method
CRISPR
Exp_Name
SAMHD1-BGKcLV33-K562
ENCODE_series_ID
ENCSR843GJZ
Batch_ID
BGKcLV33
Pool ID
Pool-220418
Local_Set_Name
set53
ENCODE_KD_Exp_ID
ENCSR870EBU
ENCODE_CN_Exp_ID
ENCSR271ZAB
Rep1
SAMHD1-BGKcLV33-27
Rep2
SAMHD1-BGKcLV33-28
CN1
NT-BGKcLV33-1
CN2
NT-BGKcLV33-2
Rep1_qPCR
Rep2_qPCR
Rep1_WB
69.0
Rep2_WB
73.3
Antibody Cat#
A301-036A
Antibody Lot#
LOT #1
Antibody DCC ID
Status
Submitted
Project
ENCODE4
ID
898
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
NotSatisfied
)
BGKcLV33-21
BGKcLV33-21
BGKcLV33-22
BGKcLV33-22
idx
1123
1200
1124
1201
TRCN#_or_BGC#
BGC#0000839
BGC#0000833
BGC#0000839
BGC#0000833
shRNA_or_gRNA_sequence
CTCGGGCTGTCATCGCAACG
GTACTTACCACCACCTCGAC
CTCGGGCTGTCATCGCAACG
GTACTTACCACCACCTCGAC
PAM
GGG
ACC
GGG
ACC
Name
SAMHD1_96
RTCB_93
SAMHD1_96
RTCB_93
Sample_ID
BGKcLV33-21
BGKcLV33-21
BGKcLV33-22
BGKcLV33-22
transduction_Date
12/7/21
2/22/22
12/7/21
2/22/22
days
D6
D6
D6
D6
RBP_name
SAMHD1
RTCB
SAMHD1
RTCB
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
489
1887
614
2115
WB_result
62.1
0.0
72.2155534
0.0
Ave_WB
67.1
0.0
WB_DONE_date
2/4/22
3/2/22,3/7/22
MW
72kd
55kd
IP
antibody_Cat#
A303-690A
A305-078A
LOT #1
LOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
0
0
Rep2_TPM
0
0
0
0
Action
Library_start_date
repeat_library
Note
ID
5270
5347
5271
5348
Western Blot
Western Blot info was not avaliable
Experiment Status
BGKcLV33-21
BGKcLV33-21
BGKcLV33-22
BGKcLV33-22
Sample_ID
BGKcLV33-21
BGKcLV33-21
BGKcLV33-22
BGKcLV33-22
Sample Name
Sample Name
RBP
SAMHD1
RTCB
SAMHD1
RTCB
Cell_Line
K562
K562
K562
K562
Exp UID
Status
NotSatisfied
NotSatisfied
NotSatisfied
NotSatisfied
Status_date
2022-03-30
2022-03-30
2022-03-30
2022-03-30
Project
ENCODE4
ENCODE4
ENCODE4
ENCODE4
Note
ID
10707
10767
10708
10768
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back