non-target      CRISPR in K562      Control: NT-BGKcLV33

General Information

List KD experiments controlled by BGKcLV33-1 and BGKcLV33-2


NT-BGKcLV33-1,NT-BGKcLV33-2:
  • BMS1-BGKcLV33-K562
  • CD2BP2-BGKcLV33-K562
  • CDC42EP4-BGKcLV33-K562
  • SKIV2L2-BGKcLV33-K562
  • RPS21-BGKcLV33-K562
  • RPS28-BGKcLV33-K562
  • RPUSD2-BGKcLV33-K562
  • RUVBL1-BGKcLV33-K562
  • SAMHD1-BGKcLV33-K562
  • SAP30BP-BGKcLV33-K562
  • SARNP-BGKcLV33-K562
  • SCAF8-BGKcLV33-K562
  • SEC31A-BGKcLV33-K562
  • SEC62-BGKcLV33-K562
  • SEC63-BGKcLV33-K562
  • SEPT11-BGKcLV33-K562
  • SETD1A-BGKcLV33-K562
  • SF3B2-BGKcLV33-K562
  • SF3B3-BGKcLV33-K562
  • SMG5-BGKcLV33-K562
  • SMG7-BGKcLV33-K562
  • SMG8-BGKcLV33-K562
  • SMG9-BGKcLV33-K562
  • SNW1-BGKcLV33-K562
  • SPAG9-BGKcLV33-K562
  • SPATS2-BGKcLV33-K562
  • SRA1-BGKcLV33-K562




  • Experiment Information (Status: Released)
    BGKcLV33-1BGKcLV33-1BGKcLV33-2BGKcLV33-2
    idx1103117611041177
    TRCN#_or_BGC#BGC#0000000BGC#0000000BGC#0000000BGC#0000000
    shRNA_or_gRNA_sequenceCAGTCGGGCGTCATCATGATCAGTCGGGCGTCATCATGATCAGTCGGGCGTCATCATGATCAGTCGGGCGTCATCATGAT
    PAM
    Namenon-targetnon-targetnon-targetnon-target
    Sample_IDBGKcLV33-1BGKcLV33-1BGKcLV33-2BGKcLV33-2
    transduction_Date12/7/212/22/2212/7/212/22/22
    daysD6D6D6D6
    RBP_namenon-targetnon-targetnon-targetnon-target
    qPCR_result
    Ave_qPCR
    RT-qPCR_primer-F
    RT-qPCR_primer-R
    protein_conc0027841698
    WB_result
    Ave_WB
    WB_DONE_date
    MW
    IP
    antibody_Cat#
    Antibody DCC ID
    submitted_to_DCC_date
    Rep1_TPM0000
    Rep2_TPM0000
    ActionReadyReady
    Library_start_date04/13/2204/13/22
    repeat_library
    Note
    ID5250532352515324




    Western Blot
    Western Blot info was not avaliable




    Experiment Status
    BGKcLV33-1BGKcLV33-1BGKcLV33-2BGKcLV33-2
    Sample_IDBGKcLV33-1BGKcLV33-1BGKcLV33-2BGKcLV33-2
    Sample Name
    Sample NameNT-BGKcLV33-1NT-BGKcLV33-2
    RBPnon-targetnon-targetnon-targetnon-target
    Cell_LineK562K562K562K562
    Exp UID
    StatusReleasedNotSatisfiedReleasedNotSatisfied
    Status_date2022-10-282022-03-302022-10-282022-03-30
    ProjectENCODE4ENCODE4ENCODE4ENCODE4
    Note
    ID10631106871063210688




    Library-Prep Information
    BGKcLV33-1BGKcLV33-2
    Sample #12
    Sample NameNT-BGKcLV33-1NT-BGKcLV33-2
    Sample_Name_Alias
    Index Well PositionA01B01
    Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
    LibPrep_date2022-04-062022-04-06
    Lib_IDLib-220406Lib-220406
    Tecan_Location
    Tecan
    Tecan_date
    Size_bp311303
    Peak_Molarity37.8068.10
    libSampleQC_DNA_WellDNA_Library_set53/set1/A5.pngDNA_Library_set53/set1/B5.png
    RIN9.79.8
    libSample_RNA_WellRNA_Library_set53/set1/A1.pngRNA_Library_set53/set1/B1.png
    SampleQC_methodTapeStation_2022TapeStation_2022
    SampleQC_date2022-04-182022-04-18
    Sample_IDBGKcLV33-1BGKcLV33-2
    RBPNTNT
    Batch_IDBGKcLV33BGKcLV33
    WB_result0.0000.000
    Library DescriptionTruSeq mRNATruSeq mRNA
    Repeat_Library_Suffix
    Lib_StatusSendToSequenceSendToSequence
    ProjectENCODE4ENCODE4
    ID32623263




    Sequencing Information
    BGKcLV33-1BGKcLV33-2
    Sample_IDBGKcLV33-1BGKcLV33-2
    Sample NameNT-BGKcLV33-1NT-BGKcLV33-2
    Pool IDPool-220418Pool-220418
    LocalServer_folderset53set53
    total_reads169,595,62484,566,118
    total_aligned_reads153,192,67075,043,382
    unique_aligned_reads139,920,58468,715,458
    percent_uniqueAligned0.825020.81256
    correlation_replicates0.9954490.995449
    spikein_reads99,27029,050
    percent_spikeins0.000590.00034
    original_ReadLength101101
    QC_StatusSubmittedSubmitted
    ID20292030




    Data Submission Information
    BGKcLV33-1BGKcLV33-1BGKcLV33-1BGKcLV33-1BGKcLV33-1BGKcLV33-2BGKcLV33-2BGKcLV33-2BGKcLV33-2
    ENCODE_aliasbrenton-graveley:NT-BGKcLV33brenton-graveley:NT-BGKcLV33-1brenton-graveley:L-NT-BGKcLV33-1brenton-graveley:NT-BGKcLV33-1_S55_L002_R1_001.filtered.trimmed.paired.fastq.gzbrenton-graveley:NT-BGKcLV33-1_S55_L002_R2_001.filtered.trimmed.paired.fastq.gzbrenton-graveley:NT-BGKcLV33-2brenton-graveley:L-NT-BGKcLV33-2brenton-graveley:NT-BGKcLV33-2_S56_L002_R1_001.filtered.trimmed.paired.fastq.gzbrenton-graveley:NT-BGKcLV33-2_S56_L002_R2_001.filtered.trimmed.paired.fastq.gz
    ENCODE_accessionENCSR271ZABENCBS953FSQENCLB939ZUQENCFF987NADENCFF133QHDENCBS950UYYENCLB376QVAENCFF275NXKENCFF352TAM
    object_typeexperimentbiosamplelibraryfile_fastq1file_fastq2biosamplelibraryfile_fastq1file_fastq2
    assay_typeknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seq
    Sample_IDBGKcLV33-1BGKcLV33-1BGKcLV33-1BGKcLV33-1BGKcLV33-1BGKcLV33-2BGKcLV33-2BGKcLV33-2BGKcLV33-2
    Sample NameNT-BGKcLV33-1NT-BGKcLV33-1NT-BGKcLV33-1NT-BGKcLV33-1NT-BGKcLV33-1NT-BGKcLV33-2NT-BGKcLV33-2NT-BGKcLV33-2NT-BGKcLV33-2
    SelectedYesYesYesYesYesYesYesYesYes
    StatusReleasedReleasedReleasedReleasedReleasedReleasedReleasedReleasedReleased
    Status_Date2022-10-282022-10-282022-10-282022-10-282022-10-282022-10-282022-10-282022-10-282022-10-28
    ProjectENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4
    LV53_biosample_protocolLV53_library_protocolLV53_biosample_protocolLV53_library_protocol
    protocol_URLNT-BGKcLV33-1.pdfL-NT-BGKcLV33-1.pdfNT-BGKcLV33-2.pdfL-NT-BGKcLV33-2.pdf
    ID747175517661777178817552766277727882




    File Information
    file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
    NT-BGKcLV33-1_S55_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set53/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2029NovaSeq6000100paired-ended1ENCODE46615
    NT-BGKcLV33-1_S55_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set53/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2029NovaSeq6000100paired-ended2ENCODE46671
    NT-BGKcLV33-1_Aligned.sortedByCoord.out.bamENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2029GRCh38V40NT-BGKcLV33-1_S55_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV33-1_S55_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE218092
    NT-BGKcLV33-1_Signal.Unique.strand+.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2029GRCh38V40NT-BGKcLV33-1/Aligned.sortedByCoord.out.bamENCORE218148
    NT-BGKcLV33-1_Signal.Unique.strand-.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2029GRCh38V40NT-BGKcLV33-1/Aligned.sortedByCoord.out.bamENCORE218204
    NT-BGKcLV33-1_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2029GRCh38V40NT-BGKcLV33-1/Aligned.sortedByCoord.out.bamENCORE218260
    NT-BGKcLV33-1_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2029GRCh38V40NT-BGKcLV33-1/Aligned.sortedByCoord.out.bamENCORE218316
    NT-BGKcLV33-1_quant.sfENCODE_DATA/set53/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2029GRCh38V40NT-BGKcLV33-1_S55_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV33-1_S55_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE218372
    NT-BGKcLV33-2_S56_L002_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set53/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2030NovaSeq6000100paired-ended1ENCODE46616
    NT-BGKcLV33-2_S56_L002_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set53/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab2030NovaSeq6000100paired-ended2ENCODE46672
    NT-BGKcLV33-2_Aligned.sortedByCoord.out.bamENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab2030GRCh38V40NT-BGKcLV33-2_S56_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV33-2_S56_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE218093
    NT-BGKcLV33-2_Signal.Unique.strand+.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2030GRCh38V40NT-BGKcLV33-2/Aligned.sortedByCoord.out.bamENCORE218149
    NT-BGKcLV33-2_Signal.Unique.strand-.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab2030GRCh38V40NT-BGKcLV33-2/Aligned.sortedByCoord.out.bamENCORE218205
    NT-BGKcLV33-2_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2030GRCh38V40NT-BGKcLV33-2/Aligned.sortedByCoord.out.bamENCORE218261
    NT-BGKcLV33-2_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set53/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab2030GRCh38V40NT-BGKcLV33-2/Aligned.sortedByCoord.out.bamENCORE218317
    NT-BGKcLV33-2_quant.sfENCODE_DATA/set53/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab2030GRCh38V40NT-BGKcLV33-2_S56_L002_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV33-2_S56_L002_R2_001.filtered.trimmed.paired.fastq.gzENCORE218373