RBM17      CRISPR in K562      Control: NT-BGKcLV30

General Information
RBPRBM17
Cell_LineK562
MethodCRISPR
Exp_NameRBM17-BGKcLV30-K562
ENCODE_series_IDENCSR284AXZ
Batch_IDBGKcLV30
Pool IDPool-211117
Local_Set_Nameset50_K
ENCODE_KD_Exp_IDENCSR012YIL
ENCODE_CN_Exp_IDENCSR347NKX
Rep1RBM17-BGKcLV30-9
Rep2RBM17-BGKcLV30-10
CN1NT-BGKcLV30-1
CN2NT-BGKcLV30-2
Rep1_qPCR0.0
Rep2_qPCR0.0
Rep1_WB52.6
Rep2_WB53.2
Antibody Cat#A302-497A
Antibody Lot#LOT #2
Antibody DCC IDENCAB724GMW
StatusSubmitted
ProjectENCODE4
ID867




Experiment Information (Status: NotSatisfied)
BGKcLV30-7BGKcLV30-8
idx10321033
TRCN#_or_BGC#BGC#0000756BGC#0000756
shRNA_or_gRNA_sequenceCCTGTACGATGACCTAGGAGCCTGTACGATGACCTAGGAG
PAMTGGTGG
NameRBM17_91RBM17_91
Sample_IDBGKcLV30-7BGKcLV30-8
transduction_Date8/30/218/30/21
daysD6D6
RBP_nameRBM17RBM17
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc27712412
WB_result0.00.0
Ave_WB0.0
WB_DONE_date10/1/21
MW45KD
IP
antibody_Cat#A302-497ALOT #2
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID51775178




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV30-7BGKcLV30-8
Sample_IDBGKcLV30-7BGKcLV30-8
Sample Name
Sample Name
RBPRBM17RBM17
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2021-10-282021-10-28
ProjectENCODE4ENCODE4
Note
ID1008710088




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database