non-target      CRISPR in K562      Control: NT-BGKcLV30

General Information

List KD experiments controlled by BGKcLV30-1 and BGKcLV30-2


NT-BGKcLV30-1,NT-BGKcLV30-2:
  • RBM14-BGKcLV30-K562
  • RBM17-BGKcLV30-K562
  • RBM25-BGKcLV30-K562
  • RBM26-BGKcLV30-K562
  • RBM28-BGKcLV30-K562
  • RBM8A-BGKcLV30-K562
  • RECQL5-BGKcLV30-K562
  • RIOK1-BGKcLV30-K562
  • RIOK2-BGKcLV30-K562
  • RNASEH2A-BGKcLV30-K562
  • RNPC3-BGKcLV30-K562
  • RPL29-BGKcLV30-K562
  • RPRD1B-BGKcLV30-K562
  • RPS15A-BGKcLV30-K562




  • Experiment Information (Status: Released)
    BGKcLV30-1BGKcLV30-2
    idx10261027
    TRCN#_or_BGC#BGC#0000000BGC#0000000
    shRNA_or_gRNA_sequenceCAGTCGGGCGTCATCATGATCAGTCGGGCGTCATCATGAT
    PAM
    Namenon-targetnon-target
    Sample_IDBGKcLV30-1BGKcLV30-2
    transduction_Date8/30/218/30/21
    daysD6D6
    RBP_namenon-targetnon-target
    qPCR_result
    Ave_qPCR
    RT-qPCR_primer-F
    RT-qPCR_primer-R
    protein_conc02169
    WB_result
    Ave_WB
    WB_DONE_date
    MW
    IP
    antibody_Cat#
    Antibody DCC ID
    submitted_to_DCC_date
    Rep1_TPM00
    Rep2_TPM00
    ActionReadyReady
    Library_start_date11/10/2111/10/21
    repeat_library
    Note
    ID51695170




    Western Blot
    Western Blot info was not avaliable




    Experiment Status
    BGKcLV30-1BGKcLV30-2
    Sample_IDBGKcLV30-1BGKcLV30-2
    Sample Name
    Sample NameNT-BGKcLV30-1NT-BGKcLV30-2
    RBPnon-targetnon-target
    Cell_LineK562K562
    Exp UID
    StatusReleasedReleased
    Status_date2022-02-112022-02-11
    ProjectENCODE4ENCODE4
    Note
    ID1005510056




    Library-Prep Information
    BGKcLV30-1BGKcLV30-2
    Sample #4546
    Sample NameNT-BGKcLV30-1NT-BGKcLV30-2
    Sample_Name_Alias
    Index Well PositionA07B07
    Index_tableIDT_UniqueDualIndex_96IDT_UniqueDualIndex_96
    LibPrep_date2021-11-012021-11-01
    Lib_IDLib-211101ALib-211101A
    Tecan_Location
    Tecan
    Tecan_date
    Size_bp283286
    Peak_Molarity50.5030.70
    libSampleQC_DNA_WellDNA_Library_set50/set2/A9.pngDNA_Library_set50/set2/B9.png
    RIN9.49.6
    libSample_RNA_WellRNA_Library_set50/set2/A9.pngRNA_Library_set50/set2/B9.png
    SampleQC_methodTapeStationTapeStation
    SampleQC_date2021-11-172021-11-17
    Sample_IDBGKcLV30-1BGKcLV30-2
    RBPNTNT
    Batch_IDBGKcLV30BGKcLV30
    WB_result0.0000.000
    Library DescriptionTruSeq mRNATruSeq mRNA
    Repeat_Library_Suffix
    Lib_StatusSendToSequenceSendToSequence
    ProjectENCODE4ENCODE4
    ID31323133




    Sequencing Information
    BGKcLV30-1BGKcLV30-2
    Sample_IDBGKcLV30-1BGKcLV30-2
    Sample NameNT-BGKcLV30-1NT-BGKcLV30-2
    Pool IDPool-211117Pool-211117
    LocalServer_folderset50_Kset50_K
    total_reads74,674,01456,162,812
    total_aligned_reads68,711,82650,896,292
    unique_aligned_reads62,564,73646,320,732
    percent_uniqueAligned0.837840.82476
    correlation_replicates0.9931240.993124
    spikein_reads25,54620,378
    percent_spikeins0.000340.00036
    original_ReadLength101101
    QC_StatusSubmittedSubmitted
    ID19171918




    Data Submission Information
    BGKcLV30-1BGKcLV30-1BGKcLV30-1BGKcLV30-1BGKcLV30-1BGKcLV30-2BGKcLV30-2BGKcLV30-2BGKcLV30-2
    ENCODE_aliasbrenton-graveley:NT-BGKcLV30brenton-graveley:NT-BGKcLV30-1brenton-graveley:L-NT-BGKcLV30-1brenton-graveley:NT-BGKcLV30-1_S47_L001_R1_001.filtered.trimmed.paired.fastq.gzbrenton-graveley:NT-BGKcLV30-1_S47_L001_R2_001.filtered.trimmed.paired.fastq.gzbrenton-graveley:NT-BGKcLV30-2brenton-graveley:L-NT-BGKcLV30-2brenton-graveley:NT-BGKcLV30-2_S48_L001_R1_001.filtered.trimmed.paired.fastq.gzbrenton-graveley:NT-BGKcLV30-2_S48_L001_R2_001.filtered.trimmed.paired.fastq.gz
    ENCODE_accessionENCSR347NKXENCBS915DVBENCLB622QOQENCFF670ZVOENCFF881UIXENCBS529AZEENCLB605ETOENCFF536IUOENCFF664FXS
    object_typeexperimentbiosamplelibraryfile_fastq1file_fastq2biosamplelibraryfile_fastq1file_fastq2
    assay_typeknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seqknockdown followed by RNA-seq
    Sample_IDBGKcLV30-1BGKcLV30-1BGKcLV30-1BGKcLV30-1BGKcLV30-1BGKcLV30-2BGKcLV30-2BGKcLV30-2BGKcLV30-2
    Sample NameNT-BGKcLV30-1NT-BGKcLV30-1NT-BGKcLV30-1NT-BGKcLV30-1NT-BGKcLV30-1NT-BGKcLV30-2NT-BGKcLV30-2NT-BGKcLV30-2NT-BGKcLV30-2
    SelectedYesYesYesYesYesYesYesYesYes
    StatusReleasedReleasedReleasedReleasedReleasedReleasedReleasedReleasedReleased
    Status_Date2022-02-112022-02-112022-02-112022-02-112022-02-112022-02-112022-02-112022-02-112022-02-11
    ProjectENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4ENCODE4
    LV50K_biosample_protocolLV50K_library_protocolLV50K_biosample_protocolLV50K_library_protocol
    protocol_URLNT-BGKcLV30-1.pdfL-NT-BGKcLV30-1.pdfNT-BGKcLV30-2.pdfL-NT-BGKcLV30-2.pdf
    ID586459215993606561375922599460666138




    File Information
    file_namefile_pathfile_formatoutput_typeassay_typelabSample IDplatformread_lengthrun_typepaired_endassemblygenome_annotationderived_fromcontrolled_byProjectNoteFILE_ID
    NT-BGKcLV30-1_S47_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set50_K/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab1917NovaSeq6000100paired-ended1ENCODE45845
    NT-BGKcLV30-1_S47_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set50_K/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab1917NovaSeq6000100paired-ended2ENCODE45875
    NT-BGKcLV30-1_Aligned.sortedByCoord.out.bamENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab1917GRCh38V40NT-BGKcLV30-1_S47_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV30-1_S47_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE218746
    NT-BGKcLV30-1_Signal.Unique.strand+.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1917GRCh38V40NT-BGKcLV30-1/Aligned.sortedByCoord.out.bamENCORE218776
    NT-BGKcLV30-1_Signal.Unique.strand-.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1917GRCh38V40NT-BGKcLV30-1/Aligned.sortedByCoord.out.bamENCORE218806
    NT-BGKcLV30-1_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1917GRCh38V40NT-BGKcLV30-1/Aligned.sortedByCoord.out.bamENCORE218836
    NT-BGKcLV30-1_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1917GRCh38V40NT-BGKcLV30-1/Aligned.sortedByCoord.out.bamENCORE218866
    NT-BGKcLV30-1_quant.sfENCODE_DATA/set50_K/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab1917GRCh38V40NT-BGKcLV30-1_S47_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV30-1_S47_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE218896
    NT-BGKcLV30-2_S48_L001_R1_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set50_K/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab1918NovaSeq6000100paired-ended1ENCODE45846
    NT-BGKcLV30-2_S48_L001_R2_001.filtered.trimmed.paired.fastq.gzENCODE_DATA/set50_K/fastq_trimmedfastqreadsknockdown followed by RNA-seqGraveley Lab1918NovaSeq6000100paired-ended2ENCODE45876
    NT-BGKcLV30-2_Aligned.sortedByCoord.out.bamENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbamalignmentsknockdown followed by RNA-seqGraveley Lab1918GRCh38V40NT-BGKcLV30-2_S48_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV30-2_S48_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE218747
    NT-BGKcLV30-2_Signal.Unique.strand+.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig+uniqueplus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1918GRCh38V40NT-BGKcLV30-2/Aligned.sortedByCoord.out.bamENCORE218777
    NT-BGKcLV30-2_Signal.Unique.strand-.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig-uniqueminus strand signal of unique readsknockdown followed by RNA-seqGraveley Lab1918GRCh38V40NT-BGKcLV30-2/Aligned.sortedByCoord.out.bamENCORE218807
    NT-BGKcLV30-2_Signal.UniqueMultiple.strand+.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig+allplus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1918GRCh38V40NT-BGKcLV30-2/Aligned.sortedByCoord.out.bamENCORE218837
    NT-BGKcLV30-2_Signal.UniqueMultiple.strand-.bwENCODE_DATA/set50_K/STAR_ENCORE2_trimmed_file_linksbigWig-allminus strand signal of all readsknockdown followed by RNA-seqGraveley Lab1918GRCh38V40NT-BGKcLV30-2/Aligned.sortedByCoord.out.bamENCORE218867
    NT-BGKcLV30-2_quant.sfENCODE_DATA/set50_K/salmon_ENCORE2_file_linkstranscript_quantificationtranscript quantificationsknockdown followed by RNA-seqGraveley Lab1918GRCh38V40NT-BGKcLV30-2_S48_L001_R1_001.filtered.trimmed.paired.fastq.gz,NT-BGKcLV30-2_S48_L001_R2_001.filtered.trimmed.paired.fastq.gzENCORE218897