Home
NEWS
Summary
Data Files
Search
FAQ
Admin Login
Top
EIF4A2
CRISPR
in K562
Batch: BGKcLV51
Experiment Information
Sequencing Information
Data Submission
Files
Experiment Information
Western Blot
Experiment Status
Experiment Information (Status:
Experimented
)
BGKcLV51-55
BGKcLV51-56
idx
0
0
TRCN#_or_BGC#
BGC#0001466
BGC#0001466
shRNA_or_gRNA_sequence
CGTAAGCATAGATGCCACGA
CGTAAGCATAGATGCCACGA
PAM
AGG
AGG
Name
EIF4A2_94
EIF4A2_94
Sample_ID
BGKcLV51-55
BGKcLV51-56
transduction_Date
9/30/2025
9/30/2025
days
D6
D6
RBP_name
EIF4A2
EIF4A2
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc
2543
3049
WB_result
Ave_WB
WB_DONE_date
10/27/25,10/22/25
MW
46 kDa
#12
IP
antibody_Cat#
GTX107484
lot# 1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM
0
0
Rep2_TPM
0
0
Action
Library_start_date
repeat_library
Note
ID
6278
6279
Western Blot
Western Blot info was not avaliable
Experiment Status
Sample_ID
Sample Name
Sample Name
RBP
Cell_Line
Exp UID
Status
Status_date
Project
Note
ID
Library-Prep
Sequencing
Library-Prep Information
Library info was not avaliable
Sequencing Information
Sequencing info was not avaliable
Data Submission Information
DCC submission information was not avaliable
File Information
Files of the experiment was not avaliable in the database
Back