RPS8      CRISPR in K562      Batch: BGKcLV48

Experiment Information (Status: NotSatisfied)
BGKcLV48-69BGKcLV48-70
idx00
TRCN#_or_BGC#BGC#0001380BGC#0001380
shRNA_or_gRNA_sequenceATCCCCTTTTCAGACTCCTGATCCCCTTTTCAGACTCCTG
PAMAGGAGG
NameRPS8_66RPS8_66
Sample_IDBGKcLV48-69BGKcLV48-70
transduction_Date4/15/254/15/25
daysD6D6
RBP_nameRPS8RPS8
qPCR_result
Ave_qPCR
RT-qPCR_primer-F
RT-qPCR_primer-R
protein_conc21412352
WB_result38.766.9
Ave_WB
WB_DONE_date5/14/25,5/8/25
MW24kd
IP
antibody_Cat#A305-017ALOT #1
Antibody DCC ID
submitted_to_DCC_date
Rep1_TPM00
Rep2_TPM00
Action
Library_start_date
repeat_library
Note
ID62056206




Western Blot
Western Blot info was not avaliable




Experiment Status
BGKcLV48-69BGKcLV48-70
Sample_IDBGKcLV48-69BGKcLV48-70
Sample Name
Sample Name
RBPRPS8RPS8
Cell_LineK562K562
Exp UID
StatusNotSatisfiedNotSatisfied
Status_date2025-08-062025-08-06
ProjectENCORE2ENCORE2
Note
ID1431414315




Library-Prep Information
Library info was not avaliable




Sequencing Information
Sequencing info was not avaliable




Data Submission Information
DCC submission information was not avaliable




File Information
Files of the experiment was not avaliable in the database